Research Article
Print
Research Article
First record and description of three new species in the land snail genus Diplommatina Benson, 1849 (Caenogastropoda, Diplommatinidae) from Satun Province, Thailand
expand article infoTuangthong Boonmachai‡, Elizabeth A. Bergey§, Nattawadee Nantarat‡
‡ Chiang Mai University, Chiang Mai, Thailand
§ University of Oklahoma, Norman, United States of America

Corresponding author: Nattawadee Nantarat ( n_nantarat@yahoo.com )

Academic editor: Frank Köhler
© 2023 Tuangthong Boonmachai, Elizabeth A. Bergey, Nattawadee Nantarat.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Boonmachai T, Bergey EA, Nantarat N (2023) First record and description of three new species in the land snail genus Diplommatina Benson, 1849 (Caenogastropoda, Diplommatinidae) from Satun Province, Thailand. Zoosystematics and Evolution 99(1): 195-207. https://doi.org/10.3897/zse.99.99030
ZooBank: urn:lsid:zoobank.org:pub:E28DD35A-30EA-4C53-B5A6-F0A80CA0CFC0
Open Access

Abstract

The micro land snail genus Diplommatina (family Diplommatinidae) is widely distributed in Southeast Asia and includes many endemic species. Three new species of Diplommatina are described from Satun Province in southern Thailand. Diplommatina bulonensis sp. nov., D. laemsonensis sp. nov. and D. prakaiphetensis sp. nov. are distinguished from other species in the genus by their shell size and shape, the number of radial ribs on the penultimate whorl, the number of whorls, and features of the peristome. The agreement between phylogenetic tree based on analyses of COI and 16S sequences and comparative morphology support the delineation of these new species which, when compared to related species, belong to well-differentiated clades. The K2P distance between any of the three new species and other Diplommatina species included in the molecular phylogenetic analysis was at least 5.5% in COI and 3.9% in 16S. Two of the three new species (D. prakaiphetensis sp. nov. and D. bulonensis sp. nov.) are apparently endemic to Prakaiphet Hill and Bulon Pai Island, respectively. Additionally, we documented a new regional record for D. naiyanetri in Satun Province. These new species and records contribute to the knowledge of Thailand’s land snail biodiversity and highlight the need of conservation protections for regional karst habitats.

Key Words

endemic, limestone, micro land snail, phylogeny, taxonomy

Introduction

Southern Thailand is located in the transition zone between two major biodiversity hotspots, the Indo-Burma and Sundaland – both of which have numerous endemic species (Myers et al. 2000). Satun Province in southern Thailand is characterized by karst features, with limestone mountains, foothills, and coastal islands. Satun’s limestone hills support high biodiversity and endemism in micro land snails (Panha and Burch 2005). The taxonomy of micro land snails in Thailand’s other limestone areas has been studied comprehensively over the previous two decades, resulting in descriptions of several new species (Panha and Burch 2005). However, Satun’s microsnail fauna remains largely unexplored.

Recent studies suggest that there are only five genera of micro land snails in Satun Province; namely, Gyliotrachela Tomlin, 1930, Hypselostoma Benson, 1856, Aulacospira Möllendorff, 1890, Sinoennea Kobelt, 1904 and Diplommatina Benson, 1849 (Panha and Burch 2005; Dumrongrojwattana and Womgkamhaeng 2013; Dumrongrojwattana and Tanmuangpak 2020). Among these five genera, the genus Diplommatina is very diverse and is widely distributed in Asia; including India, Myanmar, Laos, Thailand, Malaysia, Indonesia, Japan and northern Australia (Kobelt 1902; Thiele 1929; Wenz 1939; Vermeulen 1993). The large number of species are usually diagnosed solely by shell characters (Neubert and Bouchet 2015). The shells of Diplommatina are generally conical in shape, with radial ribs, a lipped aperture, and an operculum (Kobelt 1902; Panha and Burch 2005; Yamazaki et al. 2015; Nurinsiyah and Hausdorf 2017). Of the more than 400 described species of Diplommatina (Kobelt 1902; Thiele 1929; Wenz 1939; Vermeulen 1993), 22 species that are known to occur in Thailand and about 28 additional species are known from the neighboring countries of Malaysia, Singapore and Indonesia (van Benthem Jutting 1959; Maassen 2001a; Maassen 2002; Panha and Burch 2005; Tongkerd et al. 2013; Foon et al. 2017; Inkhavilay et al. 2019; Dumrongrojwattana et al. 2020). Among the 10 species reported from southern Thailand (Maassen 2001b; Panha and Burch 2005; Tongkerd et al. 2013; Inkhavilay et al. 2019; Dumrongrojwattana et al. 2020), only a single species, D. canaliculata, has previously been documented in Satun province (Panha and Burch 2005).

The shell characters used to identify Diplommatina species (Kobelt 1902; Panha and Burch 2005; Yamazaki et al. 2015; Nurinsiyah and Hausdorf 2017) may display adaptation to environmental characteristics, including the presence of predators (Schilthuizen et al. 2006). As a consequence, morphological features may be confusing and molecular phylogenetic techniques can be powerful tools for resolving the taxonomy and additionally inform phylogenetic relationships among snail taxa (Douris et al. 1998; Chiba 1999; Thacker and Hadfield 2000; Holland and Hadfield 2002; Steinke et al. 2004; Desouky and Busais 2012). The DNA barcoding markers of cytochrome c oxidase subunit 1 mitochondrial gene (COI) and 16S ribosomal DNA (16S rDNA) have been used in discriminating land snail species, including those within Diplommatinidae, and to investigate phylogenetic relationships (Webster et al. 2012; Liew et al. 2014).

Within a larger study of the microsnails of karst areas in Saturn Province, we especially targeted the genus Diplommatina. After conducting an extensive field survey, we used both morphological and molecular analyses to identify known species and describe new species.

Materials and methods

Ethical statements

We followed the guidelines for animal care in the International Guiding Principles of Biomedical Research Involving Animals (Council for International Organizations of Medical Sciences: CIOMS) including the relevant document (U1-03304-2559 to NN.).

Specimen sampling

Karst areas throughout Satun Province, Thailand (Fig. 1) were surveyed for land snails during the rainy seasons in December 2020 through January 2022. Specimens of Diplommatina were collected by visual searching with one to three searchers and up to three hours of searching per site. Snails were found on soil surfaces, on limestone, stones, wood, moss and under leaf litter. Micro land snails were especially common in limestone crevices and on moist surfaces. Both live snails and empty shells were collected. All live specimens were drowned in water, preserved in 95% ethanol and processed in the Biology Department, Faculty of Science, in Chiang Mai University.

Figure 1. 

Localities of micro land snail sampling in Satun Province, Thailand. A. Bulon Pai Island; B. Talutao Island; C. Khao Yai Island; D. Laem Son Hill; E. Prakaiphet Hill; F. Tharn Pliew Waterfall; G. Phu Pha Phet Cave. The symbols without letters show previous records for different species of Diplommatina that are known from Thailand (Maassen 2001b; Panha and Burch 2005; Tongkerd et al. 2013; Inkhavilay et al. 2019; Dumrongrojwattana et al. 2020).

Morphological study

All Diplommatina specimens were identified by comparing shell morphology with type specimens and the original descriptions. Specimens of Diplommatina were examined using a Leica MZ16 microscope and photographs were taken using the Leica Application Suite Version 3.4.0 program. Shell morphological characteristics, including shell height and width and aperture height and width, were measured from digital images using ImageJ (Schneider et al. 2012). Shell morphological measurements and ratios among measurements (e.g., shell height to width) of each morphospecies were analyzed using ANOVA (α = 0.05) using IBM SPSS Statistics ver. 22.0.

The outer wall of the body whorl of at least two shells of each species was removed to reveal the internal lamellar features (Vermeulen 1993; Panha and Burch 2005; Neubert and Bouchet 2015; Budha et al. 2017), which were photographed.

Shells were cleaned by using sonication prior to viewing with a scanning electron microscope (SEM). Dried shells were sputter-coated with gold and examined with a JSM 5910 LV scanning electron microscope at the Electron Microscope Research and Service, Faculty of Science, Chiang Mai University.

Using a dissecting microscope, the radulae of microsnails were extracted from the buccal cavity, cleared in 1% sodium hydroxide overnight and then washed with distilled water. Radulae were dehydrated by immersion in increasing alcohol concentrations (10%, 30%, 50%, 70%, 80% and 95%) (Nantarat et al. 2014). The dehydrated radulae were fixed onto SEM stubs with carbon tape and coated with gold (Franklin et al. 2007) and viewed on the scanning electron microscope.

Molecular study and phylogenetic analyses

This study included data from GenBank for fourteen species and three unidentified species of Diplommatina (totalling 20 records) (Rundell 2008; Webster et al. 2012), and twelve records of species from other genera in the family that were used as outgroups to root the tree (Rundell 2008; Webster et al. 2012). Sequences of ten individuals of Diplommatina spp. collected during our surveys were included in our molecular phylogenetic analysis.

The foot tissue of the ethanol-preserved snails was removed for DNA extraction. The samples were incubated with 150 μl Chelex 100 and 3 μl Proteinase K for 1 hour at 55 °C, followed by 30 minutes at 95 °C (de Lamballerie et al. 1992). All DNA samples were stored at -20 °C for later use. The COI gene was amplified using primers LCO1490 (5’- GGTCAACAA ATCATA AAGATATTGG -3’) and HCO2198 (5’- TAAACTTCAGGGTGACCAAAA AATCA -3’) (Folmer et al. 1994). PCR reactions were performed with cycle parameters of 94 °C for 3 min, followed by 36 cycles of 94 °C for 30 s, 50 °C for 60 s, and 72 °C for 1 min, and a final extension step at 72 °C for 5 min. The 16S rRNA gene was amplified by using primers 16Sar (5’- CGCCTGTTTATCAAAAACAT-3’) and 16Sbr (5’-CCGGTCTGAACTCAGATCACGT-3’) (Palumbi 1996). PCR amplification was performed at 95 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 45 °C for 1 min, and 72 °C for 2 min, and then a final 72 °C for 5 min. Primer PCR products were checked using 1% (w/v) agarose gel electrophoresis with 1X TBE buffer. Purification and sequencing were performed using Barcode-Tagged Sequencing (BTSeq) Services. After sequencing, the sequences were proofread on chromatograms, and the coding was aligned using Clustal W (Thompson et al. 1994) and then manually edited with MEGA X (Kumar et al. 2018). A total of 42 sequences were used in this study. New sequences have been deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank) and are shown in Table 2. Phylogenetic trees were constructed using Maximum likelihood (ML) and Bayesian inference (BI) methods. Maximum likelihood analyses were performed based on the TIM3+F+I+G4 model for the COI gene and GTR+F+I+G4 model for the 16S gene by using IQ-TREE on XSEDE and CIPRES (Miller et al. 2010; Nguyen et al. 2015) with 1000 bootstrap repeats (Hoang et al. 2018). The Bayesian Inference analysis was performed using MrBayes (Ronquist et al. 2012) version 3.2.7. Parameter settings were 4 nchains and 4 nruns in a Markov Chain Monte Carlo algorithm (MCMC). The BI analysis was performed for 10,000,000 generations, with a temperature parameter for heating = 0.8, sampled every 100 generations, and setting burn-in at 25% of the run (Ronquist and Huelsenbeck 2003).

Morphological abbreviations

AH aperture height

AH/AW aperture height/ aperture width

AW aperture width

cd columellar denticle

col columellaris

con constriction

N1 ribs/0.5 mm on the penultimate whorl

N2 total ribs on the penultimate whorl

prt parietalis

SH shell height

SH/SW shell height/ shell width

SW shell width

tp transversal palatalis

W number of whorls.

Results

Land snails from 41 survey sites in Satun Province were identified based on morphological characters combined with molecular analysis. Five species of Diplommatina were found. One species, D. canaliculata, had previously been reported from Satun Province and a second species, D. naiyanetri, is a new provincial record and was found on Tarutao Island. The three remaining species are new species and are described below.

Systematics

Family Diplommatinidae Pfeiffer, 1856

Diplommatina Benson, 1849

Type species

Diplommatina folliculus Pfeiffer, 1846.

Diplommatina bulonensis Boonmachai & Nantarat, sp. nov.

https://zoobank.org/94CA70AE-54F1-4B9D-8604-29766AE5FB80
Figs 2A, 3A–C

Type material

Holotype CMUZ 9050001 (Fig. 2A); Shell measurements: SH = 2.72 mm, SW = 1.27 mm, AH = 0.94 mm, AW = 0.91 mm, W = 6 1/2. Paratypes CMUZ 9050002-9050006 (5 shells); Shell measurements: SH = 2.58–2.82 mm, SW = 1.26–1.34 mm, AH = 0.97–1.04 mm, AW = 0.92–1.03 mm, W = 6 1/2–7 1/2.

Figure 2. 

Shell morphology of Diplommatina from Satun Province. A. D. bulonensis sp. nov. (Holotype CMUZ 9050001; Bulon Pai Island); B. D. laemsonensis sp. nov. (Holotype CMUZ 9050019; Laem Son Hill); C. D. prakaiphetensis sp. nov. (Holotype CMUZ 9050066; Prakaiphet Hill); D. D. naiyanetri (CMUZ 905090; Tarutao Island); E. D. canaliculata (CMUZ 9050158; Tharn Pliew Waterfall).

Type locality

Thailand, Satun Province, La-ngu District, Bulon Pai Island on limestone rocks and under leaves, 6°49'53.3"N, 99°35'19.5"E, 22 December 2020, coll. T. Booonmachai.

Other material examined

Thailand, Satun Province; La-ngu District, Bulon Pai Island, 6°49'53.3"N, 99°35'19.5"E, 22 December 2020: CMUZ 9050007-9050016 (10 shells); La-ngu District, Bulon Pai Island, 6°49'53.3"N, 99°35'19.5"E, 15 February 2022: CMUZ 9050017-9050018 (2 shells).

Etymology

The specific epithet bulonensis is an adjective referring to the type locality (Bulon Pai Island in Satun Province, Thailand).

Differential diagnosis

Among approximately 400 species of Diplommatina, the new species is most similar to D. conditioria Maassen, 2007, D. baliana Fulton, 1899, D. maduana Laidlaw, 1949, D. gomantongensis Smith, 1894 and D. antheae Vermeulen, 1993 (Table 1). Typical characteristics shared by D. bulonensis with all these species are shell dextral with a slender fusiform shape with rather evenly rounded sides, radial ribs not sinuous, constriction situated halfway on the parietal side of the peristome and aperture round. However, D. bulonensis sp. nov. differs from D. gomantongensis and D. antheae by the presence of a transverse palatalis and an inconspicuous columellar denticle in the aperture (Fig. 4A). D. bulonensis sp. nov differs in the combination of shell height, shell width, aperture height and aperture width from D. maduana and D. antheae (Table 1). D. bulonensis sp. nov differs from D. conditioria and D. maduana in the number of whorls (Table 1) and differs from D. maduana, D. gomantongensis, D. antheae and D. baliana in the number of radial ribs/0.5 mm on the penultimate whorl (Table 1). D. bulonensis sp. nov has fewer radial ribs on body whorls above the aperture than D. conditioria (12–13 vs. 16 ribs/1 mm) (Maassen 2007). Moreover, it differs from D. baliana in having a columella fold.

Description

Shell dextral, fusiform, convex and red rushes or red-orange in color (Figs 2A, 3A). Penultimate whorl slightly wider than body whorl, side flat. Spire conical with slightly convex sides. Suture impressed. Constriction level with the middle parietal side of the peristome, with three lamellae: one parietalis very distinct, one distinct and long transversal palatalis and one distinct columellaris. (Fig. 4A, B). Protoconch smooth with dimples and about 2 1/2 whorls (Fig. 3B). Radial ribs straight, inconspicuous but distinct, moderately spaced about 6 1/2–7 ribs/0.5 mm on the penultimate whorl (Table 1). The aperture slightly tilted against the coiling axis, columellar denticle slightly weak in the aperture. Peristome double, rather expanding, palatal side not sinuous, basal side and columella side weakly sinuous. Outer peristome expanded less than inner peristome, inner peristome expanded at parietalis side, with a palatal lip. Umbilicus closed. Operculum multispiral, flat, corneous, transparent, slightly concave, outer surface smooth, inner surface smooth with raised peripheral circular margin (Fig. 3C). The radula of the taenioglossate type (Fig. 5B). The central tooth round and flat with seven cusps of similar size. The basal plate of the central tooth, cuspate and small. The lateral teeth with five cusps. The marginal teeth with inner and outer teeth, the inner teeth with seven small cusps and the outer teeth with five cusps and larger than the inner teeth (Fig. 5B).

Figure 3. 

Scanning electron microscope of shell morphology, protoconch and operculum of Diplommatina new species. A–C. D. bulonensis sp. nov. (Bulon Pai Island); D–F. D. laemsonensis sp. nov. (Laem Son Hill); G–I. D. prakaiphetensis sp. nov. (Prakaiphet Hill).

Figure 4. 

Shell internal terminology of new species genus Diplommatina from Satun Province under the stereo microscope and the drawing. A, B. D. bulonensis sp. nov. (Bulon Pai Island); C, D. D. laemsonensis sp. nov. (Laem Son Hill); E, F. D. prakaiphetensis sp. nov. (Prakaiphet Hill).

Figure 5. 

Radular morphology of Diplommatina. A. Diplommatina laemsonensis sp. nov. (Laem Son Hill); B. Diplommatina bulonensis sp. nov. (Bulon Pai Island); C. Diplommatina prakaiphetensis sp. nov. (Prakaiphet Hill). Colours show the position of the teeth of the radula; blue: central tooth, yellow: the basal plate of the central tooth, green: lateral teeth, pink: inner marginal teeth, and red: outer marginal teeth.

Diplommatina laemsonensis Boonmachai & Nantarat, sp. nov.

https://zoobank.org/A1F06C5D-F1EC-41FC-8345-D9BA7693D8E2
Figs 2B, 3D–F

Type material

Holotype CMUZ 9050019 (Fig. 2B); Shell measurements: SH = 2.26 mm, SW = 1.17 mm, AH = 0.77 mm, AW = 0.83 mm, W = 7. Paratypes CMUZ 9050020-9050024 (5 shells); Shell measurements: SH = 2.14–2.49 mm, SW = 1.08–1.21 mm, AH = 0.76–0.91 mm, AW = 0.79–0.86 mm, W = 6 1/2–7.

Type locality

Thailand, Satun Province, La-ngu District, Limestone Hill, 6°54'43.7"N, 99°41'59.0"E, 25 December 2020, coll. T. Booonmachai.

Other material examined

Thailand, Satun Province; La-ngu District, Limestone Hill, 6°54'43.7"N, 99°41'59.0"E, 25 December 2020: CMUZ 9050025-9050047 (23 shells); La-ngu District, Khoa Yai Island, 6°83'08.6"N, 99°69'70.1"E, 21 December 2022: CMUZ 9050048-9050065 (18 shells).

Etymology

The specific epithet laemsonensis is an adjective referring to the type locality (Laem Son subdistrict, Lan-gu district, Satun Province, Thailand).

Differential diagnosis

Among the sinistral species of Diplommatina, Diplommatina laemsonensis sp. nov. is most similar to D. diminuta Möllendorff, 1891, D. sinistra Tomlin, 1938 and D. acme Laidlaw, 1949 (Table 1). All these species share a moderately slender fusiform shape, rounded periphery, shell height range and number of whorls (Table 1). However, Diplommatina laemsonensis differs from D. acme, D. diminuta and D. sinistra in the number of radial ribs in the penultimate whorl (Table 1). It differs from D. diminuta in shell width and the ratio of AH/AW (Table 1). Moreover, it differs from D. diminuta by the absence of teeth on the basal margin of the aperture and differs from D. sinistra in having a distinct columellar denticle in the aperture.

Description

Shell sinistral, fusiform, convex and honey brown in color (Figs 2B, 3D). The penultimate whorl widest. Spire conical with slightly convex sides. Suture impressed. Constriction level with the edge between the parietal and columellar side of the peristome, with three lamellae: one distinct parietalis which starts at the constriction, one transversal palatalis, one distinct columellaris which continues into the tuba and visible in the aperture (Fig. 4C, D). Protoconch sculpture smooth with fine pitting and about 1 whorl (Fig. 3E). Radial ribs straight, distinct, rather dense on top of the teleoconch, suddenly changing to a moderately spaced about 8–9 ribs/0.5 mm on the penultimate whorl (Table 1). The aperture tilted up to 30 °C in relation to the coiling axis, columellar denticle visible in the aperture, deflected downwards. Peristome double, expanding, palatal side rounded with slightly edge, basal side with edge slightly protruding. Outer peristome expands beyond the inner peristome with about four layers, inner peristome with distinct a palatal, basal and columellar lips. Umbilicus closed. Operculum multispiral, flat, corneous, transparent, slightly concave, outer surface smooth with small pits distributed over whole surface, inner surface smooth with raised peripheral circular margin (Fig. 3F). The radula of the taenioglossate type (Fig. 5A). Central tooth strong with a large central cusp, with 2 pairs of developed lateral cusps. Basal plate of central tooth prominent with 2 small cusps. The lateral teeth with six cusps, the third cusp longest. In the marginal teeth, the inner teeth larger than the outer, with six cusps, the third cusp longest. The outer tooth with four cusps (Fig. 5A).

Diplommatina prakaiphetensis Boonmachai & Nantarat, sp. nov.

https://zoobank.org/C468B471-1728-4C9C-ABC3-4C1530C644D8
Figs 2C, 3G–I

Type material

Holotype CMUZ 9050066 (Fig. 2C); Shell measurements: SH = 1.76 mm, SW = 0.89 mm, AH = 0.66 mm, AW = 0.64 mm, W = 6 1/2. Paratypes CMUZ 9050067-9050071 (5 shells); Shell measurements: SH = 1.62–1.75 mm, SW = 0.83–0.90 mm, AH = 0.59–0.69 mm, AW = 0.61–0.72 mm, W = 6–7.

Type locality

Thailand, Satun Province, Thung Wa District, Prakaiphet Hill, 7°00'00.1"N, 99°46'08.7"E, 19 January 2022, coll. T. Boonmachai.

Other material examined

Thailand, Satun Province, Thung Wa District, Prakaiphet Hill, 7°00'00.1"N, 99°46'08.7"E, 19 January 2022: CMUZ 9050072–9050088 (17 shells).

Etymology

The specific epithet prakaiphetensis is an adjective referring to the type locality (Prakaiphet Hill in Na Thon subdistrict, Thung Wa District, Satun Province, Thailand).

Differential diagnosis

Among sinistral diplommatinids, Diplommatina prakaiphetensis sp. nov. most closely resembles D. krabiensis Panha & J. B. Burch, 1998 from Thailand, and D. karoensis Maassen, 2002 from Sumatra, Indonesia as all these species share a minute size, an ovate shell shape with rather flat whorls, radial ribs being distinct and comparatively widely spaced. However, D. prakaiphetensis sp. nov. differs from both other species in the number of whorls (Table 1). It also differs from D. karoensis in the number of radial ribs/0.5 mm on the penultimate whorl and ratio of SH/SW (Table 1). Moreover, the absence of radial ribs on the body whorl on the parietal side and slightly wavy radial ribs distinguishes it from D. krabiensis.

Description

Shell sinistral, fusiform, thin, convex, color Aztec gold, (Figs 2C, 3G). Penultimate whorl width slightly smaller than the body whorl, suture impressed. Constriction level with the middle parietal side of the peristome, with three lamellae: one parietalis, one short transverse palatalis and one prominent columellaris that continues into the tuba and is visible in the aperture (Fig. 4E, F). Protoconch smooth, with very fine pits, about 1 1/4 whorl (Fig. 3H). Radial ribs are very fine and closely spaced on top of the teleoconch; the following ones are more widely spaced, and become prominent on third to last whorl and are wavy, inconspicuous or almost absent on the body whorl on the parietal side of peristome with about 3–4 ribs/0.5 mm on the penultimate whorl (Table 1). Aperture rounded, columellar denticle distinct in the aperture. Peristome double and expanding. The outer peristome expanding beyond the inner, with palatal and columellar side protruding, basal side not protruding, inner peristome expanding with a weak parietal lip. Umbilicus closed. Operculum multispiral, flat, corneous, transparent, slightly concave, outer surface smooth, inner surface smooth with a large ridge and raised peripheral circular edge (Fig. 3I). The radula of the taenioglossate type (Fig. 5C). The central tooth strong and pointed cusps with a large central cusp, two pairs of developed lateral cusps. The basal plate of the central tooth prominent with two small cusps. The lateral teeth with five cusps; the longest is the third cusp. In the marginal teeth, the inner teeth larger than the outer, with four cusps, and the longest is the second cusp. The outer marginal teeth with three cusps (Fig. 5C).

Molecular phylogenetic analyses

Sequences from a total of 30 individuals of Diplommatina spp. and 12 individuals from four additional diplommatinid genera (Hungerfordia Beddome, 1889, Palaina Semper, 1865, Opisthoporus Manter, 1947 and Opisthostoma W. T. Blanford & H. F. Blanford, 1860; the out groups) were used for phylogenetic reconstruction (Table 2). The concatenated alignment of COI and 16S sequences had a total length of 996 base pairs (COI = 594, 16S = 402). The phylogenetic tree based on the analyses of the concatenated COI and 16S sequences supported Diplommatina as a monophyletic group. Within Diplommatina, the phylogenetic tree was divided into three main clades. Clade A was strongly supported and included all dextral species from Boneo, Peninsular Malaysia, and southern Thailand (Fig. 6). Within this clade, D. bulonensis sp. nov. formed the sister group containing D. gomantongensis, Diplommatina sp. from Borneo and D. canaliculata (Fig. 6). Clade B consisted of most Diplommatina species from Borneo, such as D. centralis, D. rubra, D. rubicunda, D. electa and two Diplommatina spp., plus D. laidlawi from Peninsular Malaysia. Clade C contained the sister pair of D. prakaiphetensis sp. nov. and D. laemsonensis sp. nov. The pair’s sister group was D. naiyanetri (Fig. 6).

Figure 6. 

Phylogenetic tree of Diplommatina species based on COI and 16S genes. The number on each clade are statistic supports based on ML and BI methods, respectively. The ML exceed less than 60% of the Boorstrap support and the posterior probability of BI is greater than 0.70.

Pairwise K2P genetic distances between Diplommatina species ranged from 3.9–21.8% for COI and 3.2–21.3% for 16S. Intraspecific K2P distances ranged from 0–1.9% and 0 to 1.2% for COI and 16S, respectively. The new species were separated from other species by K2P distances of at least 5.5% in COI and 3.9% in 16S. The intraspecific K2P distances were minuscule (Suppl. material 1).

Discussion

Both morphological and molecular evidence support the recognition of the three new species Diplommatina laemsonensis sp. nov, Diplommatina bulonensis sp. nov. and Diplommatina prakaiphetensis sp. nov. Two of the species are presumed to be endemic to the region: D. bulonensis sp. nov. has been found only on Bulon Pai Island and D. prakaiphetensis sp. nov. has been found only on Prakaiphet Hill on the mainland. In addition, we found an additional regional record of D. naiyanetri (Figs 1–3).

One species, D. canaliculata, had previously been reported from Satun Province. This species was also found in other areas of Thailand, such as Trang, Nakhon Si Thammarat and Krabi Provinces (Panha and Burch 2005), as well as in Malaysia (Peninsular and Borneo) and Indonesia (Sumatra, Java and Borneo) (Laidlaw 1949; Vermeulen 1993; Maassen 2001a, 2002). A second species, D. naiyanetri, is a new Satun Province record and was found on Tarutao Island. Previously, this species had been reported in three other provinces in Thailand; namely, Trang, Phatthalung and Nakhon Si Thammarat (Panha and Burch 2005). All of these provinces share a similar origin of Paleozoic limestones on the continental Shan-Thai fragment, which may explain the observed present-day pattern of distribution (Agematsu et al. 2006a, b).

Several shell morphological characters can be used to distinguish the new species from other Diplommatina species; these include shell height, shell width, aperture height, aperture width, the ratio of SH/SW, the ratio of AH/AW, the internal lamellar system, radial ribs on the penultimate whorl, the number of whorls and the structure of the peristome. Moreover, scanning electron microscopy (SEM) showed additional details in the sculpturing and number of whorls of the protoconch in the three new species (Fig. 3). These protoconch features have previously been used as criteria for identification in Diplommatina species (Panha and Burch 2001; Maassen 2002; Dumrongrojwattana et al. 2020). Furthermore, this is the first study of radular morphology of Diplommatina. Differences in the shape of basal plate, and the shape and number of cusps on central tooth were observed in the three new species (Fig. 3), indicating that radular characters are useful for identification within this genus. In contrast, the opercula are very similar, being paucispiral, flat, transparent, with a smooth outer and inner surface with a raised peripheral circular margin. The operculum is infrequently used in taxonomy among diplommatinids because it has few characters and is very similar among species (Neubert and Bouchet 2015).

Molecular phylogenetic techniques were used to verify taxonomy and indicate classification, and are especially useful where morphological characters alone do not provide clear delineations (Douris et al. 1998; Chiba 1999; Thacker and Hadfield 2000; Holland and Hadfield 2002; Steinke et al. 2004; Desouky and Busais 2012). The phylogenetic tree revealed three main clades within Diplommatina and species within these clades shared the same sinistral or dextral shell spire and had similar distribution patterns. Clade A was a strongly supported clade consisting of dextral species from Borneo and Peninsular Malaysia, southern Thailand and Taiwan (Fig. 6). D. bulonensis sp. nov. had high support as a sister group of D. gomantongensis and D. canaliculata and was also placed in the same clade as D. hidagai from Thailand (Fig. 6). The phylogenetic tree was consistent with the pattern of difference in shell morphology of D. bulonensis sp. nov. versus D. canaliculata and D. hidagai in the ratio of SH/SW and the number of whorls, and the difference from D. gomantongensis in the radial ribs/0.5 mm on the penultimate whorl (Table 1).

Table 1.
Download as
CSV
XLSX

Comparison of shell morphological characters of closely related Diplommatina species with new species. Shell morphological characters were tested using one-way ANOVA (P < 0.05).

Species Characters (mm)
(SH) (SW) (AH) (AW) SH/SW AH/AW W N1 N2
D. bulonensis sp. nov. 2.58–2.82 (2.71±0.08)* 1.26–1.34 (1.31±0.04)* 0.94–1.04 (1.00±0.03)* 0.91–1.03 (0.97±0.04)* 1.93–2.15 (2.07±0.07) 0.96–1.10 (1.03±0.05)* 6 1/2–7 (6.95±0.27) 6–7 (6.33±0.52)* 44–51 (47.33±3.51)*
D. laemsonensis sp. nov. 2.14–2.49 (2.34±0.10)* 1.08–1.21 (1.15±0.04)* 0.76–0.91 (0.82±0.05)* 0.79–0.86 (0.81±0.02)* 1.94–2.14 (2.04 ±0.08)* 0.93–1.09 (1.00±0.05) 6–7 (6.86±0.31) 8–9 (8.50±0.55)* 36–44 (39.33±4.16)*
D. prakaiphetensis sp. nov. 1.62–1.76 (1.69±0.04)* 0.83–0.90 (0.86±0.02)* 0.59–0.69 (0.64±0.03)* 0.61–0.72 (0.66±0.03* 1.92–2.06 (1.97±0.04)* 0.89–1.05 (0.97±0.06)* 6–7 (6.88±0.30) 3–4 (3.50±0.58)* 15–17 (16.00±1.00)*
D. karoensis 1.60–1.90 (1.75±0.21)* 0.90–1.10 (1.00±0.14)* – – 1.73–1.78 (1.76±0.04)* – 5–5 1/2 (5.20±3.54)* 2* –
D. krabiensis 1.60–1.70 (1.65±0.71)* 0.90* – – 1.89–2.39 (2.14±0.35) – 5.75* – –
D. canaliculata 3.20–4.95 (3.93±0.81)* 1.30–2.07 (1.62±0.33)* 0.60–1.48 (0.97±0.40)* 0.50–1.67 (0.97±0.51)* 2.23–2.63 (2.43±0.17)* 0.89–1.20 (1.05±0.13)* 7–9 1/8 (8.03±0.96)* 3–5 (4.25±0.96)* –
D. hidagai 2.20–2.70 (2.45±0.35)* 1.20–1.40 (1.30±0.14)* – – 1.83–1.93 (1.88±0.07)* – 8* – –
D. naiyanetri 1.90–2.63 (2.41±0.31)* 1.00–1.13 (1.10±0.06)* 0.70–0.75 (0.73±0.03)* 0.70–0.80 (0.76±0.06) 1.90–2.35 (2.18±0.19)* 0.94–1.00 (0.96±0.03) 6–8 1/2 (7.88±1.25)* 6–7 (6.33±0.58)* 29–36 (32.67±3.51)*
D. acme 2.20* 1.00* – – 2.20* – 7 ½ – 26*
D. diminuta 2.00* 0.90* – – 2.22* – 7 ½ – 24*
D. sinistra 1.90* 1.00* – – 1.91* – 7 ½ – 24*
D. conditioria 2.50* 1.20* – – 2.08 – 6* 7* –
D. maduana 1.3–1.7 (1.50±0.28)* 0.70–0.90 (0.80±0.14)* 0.30–0.40 (0.35±0.07)* 0.30–0.40 (0.35±0.07)* 1.86–1.89 (1.88±0.02)* 1.00 5–6 1/2 (5.75±1.06)* 7–12 (9.50±3.54)* –
D. gomantongensis 2.50–3.50 (3.00±0.71)* 1.20–1.60 (1.40±0.28)* 0.50–0.60 (0.55±0.07)* 0.50–0.60 (0.55±0.07)* 2.08–2.19 (2.14±0.08) 1.00 6 1/4–7 1/2 (6.88±0.88) 3–5 (4.00±1.41)* –
D. antheae 1.60–2.10 (1.85±0.35)* 0.80–1.00 (0.90±0.14)* 0.30–0.40 (0.35±0.07)* 0.30–0.40 (0.35±0.07)* 2.00–2.20 (2.10±0.14) 1.00 5 3/4–6 8/5 (6.68±1.31) 7–13 (10.00±4.24)* –
D. baliana 2.20–2.85 (2.52±0.33)* 1.05–1.50 (1.27±0.23)* – – 1.90–2.10 (2.00±1.00) – 5 3/4–6 3/4 (6.33±0.52) 12–13 (12.50±0.71)* 36–60 (48.00±16.97)*

* Significant difference in shell morphology between Diplommatina species and new species at P < 0.05.

All sinistral species were placed in Clade B and Clade C, which were geographically distinct. All species in Clade B were from Borneo, Malaysia and all species in Clade C were from Peninsular Malaysia and southern Thailand. The close placement of D. laemsonensis sp. nov. and D. prakaiphetensis sp. nov. with their sister species D. naiyanetri in Clade C was strongly supported (Fig. 6). The phylogenetic tree agreed with the significant differences in shell morphology of D. laemsonensis sp. nov. and D. prakaiphetensis sp. nov. versus D. naiyanetri in the ratio of SH/SW, the number of whorls, and the number of radial ribs/0.5 mm on the penultimate whorl (Table 1). In addition, the genetic K2P distance based on COI and 16S genes demonstrated that the distances of the three new species were greater than the overall mean of the species in this genus. Thus, the morphological characters and molecular analysis both indicate that the three described taxa of Diplommatina in this study are, indeed, new species.

Table 2.
Download as
CSV
XLSX

List of sampling from GenBank for use in phylogenetic analysis.

Species Voucher codes Locality Accession number Reference
COI 16S
Diplommatina ventriculus Möllendorff, 1891 MOL119823 Malaysia, Perak HM753324 HM753495 Webster et al. 2012
Diplommatina centralis Vermeulen, 1993 MOL119785 Malaysia, Borneo HM753339 HM753505 Webster et al. 2012
Diplommatina electa Fulton, 1905 MOL119815 Malaysia, Borneo HM753359 HM753503 Webster et al. 2012
MOL119816 Malaysia, Borneo HM753360 HM753517 Webster et al. 2012
Diplommatina plecta Fulton, 1901 MOL119818 Malaysia, Borneo HM753362 HM753519 Webster et al. 2012
Diplommatina rubicunda Martens, 1864 MOL119819 Malaysia, Borneo HM753363 HM753520 Webster et al. 2012
Diplommatina rubra Godwin-Austen, 1889 MOL119797 Malaysia, Borneo HM753346 HM753514 Webster et al. 2012
MOL119814 Malaysia, Borneo HM753358 HM753516 Webster et al. 2012
Diplommatina laidlawi Sykes, 1903 MOL119821 Malaysia, Kelanta HM753364 HM753522 Webster et al. 2012
Diplommatina canaliculata Möllendorff, 1887 MOL119783 Malaysia, Pahang HM753338 HM753504 Webster et al. 2012
Diplommatina demorgani Laidlaw, 1949 MOL119787 Malaysia, Pahang HM753340 HM753507 Webster et al. 2012
Diplommatina suratensis Panha & Burch, 1998 MOL119827 Thailand, Krabi HM753328 HM753499 Webster et al. 2012
Diplommatina hidagai Panha, 1998 MOL119791 Thailand, Trang HM753327 HM753498 Webster et al. 2012
Diplommatina hidagai Panha, 1998 MOL119826 Thailand, Trang HM753343 HM753510 Webster et al. 2012
Diplommatina naiyanetri Panha, 1997 MOL119794 Thailand, Trang HM753344 HM753512 Webster et al. 2012
Diplommatina prava Pilsbry & Hirase, 1905 MOL119796 Taiwan HM753345 HM753513 Webster et al. 2012
Diplommatina gomantongensis Smith, 1894 MOL119800 Malaysia, Borneo HM753342 HM753509 Webster et al. 2012
Diplommatina sp. MOL119822 Malaysia, Borneo HM753365 HM753523 Webster et al. 2012
MOL119780 Malaysia, Borneo HM753337 HM753501 Webster et al. 2012
MOL119813 Malaysia, Borneo HM753357 HM753515 Webster et al. 2012
Diplommatina laemsonensis sp. nov. MCMU 0401 Thailand, Satun ON568751 OP857482 This study
MCMU 0409 Thailand, Satun OP825126 OP857486 This study
Diplommatina canaliculata Möllendorff, 1887 MCMU 0402 Thailand, Satun ON568749 OP857480 This study
Diplommatina bulonensis sp. nov. MCMU 0403 Thailand, Satun ON568752 OP857483 This study
MCMU 0410 Thailand, Satun OP825127 OP857487 This study
MCMU 0411 Thailand, Satun OP825128 OP857488 This study
Diplommatina naiyanetri Panha, 1997 MCMU 0406 Thailand, Satun ON568750 OP857481 This study
MCMU 0408 Thailand, Satun OP825125 OP857485 This study
Diplommatina prakaiphetensis sp. nov. MCMU 0407 Thailand, Satun ON568753 OP857484 This study
MCMU 0412 Thailand, Satun OP825129 OP857489 This study
Hungerfordia sp. FMNH310545 Belau EU742109 EU742028 Rundell 2008
FMNH310544 Belau EU742107 EU742026 Rundell 2008
– Belau HM753351 HM753526 Webster et al. 2012
FMNH310550 Belau EU742113 EU742032 Rundell 2008
Palaina moussoni Crosse, 1866 FMNH310574 Belau EU742089 EU742008 Rundell 2008
MOL 119811 Belau HM753355 HM753532 Webster et al. 2012
Palaina rubella Beddome, 1889 FMNH310572 Belau EU742090 EU742009 Rundell 2008
FMNH310573 Belau EU742091 EU742010 Rundell 2008
Palaina striolata Crosse, 1866 MOL 119812 Belau HM753356 HM753533 Webster et al. 2012
Opisthostoma fraternum Smith, 1905 MOL 119824 Malaysia, Borneo HM753325 HM753496 Webster et al. 2012
Opisthostoma mirabile Smith, 1893 MOL 119807 Malaysia, Borneo HM753353 HM753529 Webster et al. 2012
Opisthoporus birostris Pfeiffer, 1854 MOL.119772 Malaysia, Borneo HM753333 HM753488 Webster et al. 2012

Many tropic and subtropic karst regions support high biodiversity and endemic species of land snails, especially microsnails (Panha and Burch 2005). A variety of human activities impact limestone outcrop habitats in Southeast Asia (Sodhi et al. 2010; Hughes 2017). The destruction of limestone outcrop habitats leads to the extinction of species, especially endemic species (Sodhi et al. 2010). Hence, it is necessary to understand unique aspects of biodiversity for these small ‘hotspots’ for planning and implementing conservation strategies, especially for threatened endemic species, including land snails.

Acknowledgements

This study was mainly supported by the Thailand Research Fund (TRF) through a Royal Golden Jubilee (RGJ) Ph.D. Scholarship to TB (PHD/0248/2560). This research work also was partially supported by Chiang Mai University. Grateful thanks are extended to the Parasitology Research Laboratory for the use of instruments.

References

  • Agematsu S, Sashida K, Salyapongse S, Sardsud A (2006a) Lower and middle ordovician conodonts from the Thung Song and Thung Wa areas, southern peninsular Thailand. Paleontological Research 10(3): 215–231.
  • Agematsu S, Sashida K, Salyapongse S, Sardsud A (2006b) Ordovician-Silurian boundary graptolites of the Satun area, southern peninsular Thailand. Paleontological Research 10(3): 207–214.
  • Budha PB, Naggs F, Backeljau T (2017) The genus Diplommatina Benson, 1849 (Gastropoda: Caenogastropoda: Diplommatinidae) in Nepal, with the description of seven new species. European Journal of Taxonomy 337(337): 1–30. https://doi.org/10.5852/ejt.2017.337
  • Chiba S (1999) Accelerated evolution of land snails Mandarina in the oceanic Bonin Islands: evidence from mitochondrial DNA sequences. Evolution 53(2): 460–471. https://doi.org/10.2307/2640782
  • de Lamballerie X, Zandotti C, Vignoli C, Bollet C, de Micco P (1992) A one-step microbial DNA extraction method using “Chelex 100” suitable for gene amplification. Research in Microbiology 143(8): 785–790. https://doi.org/10.1016/0923-2508(92)90107-Y
  • Desouky MMA, Busais S (2012) Phylogenetic relationships of the land snail; Eobania vermiculata (Müller, 1774) from Egypt and Saudi Arabia. A combined morphological and molecular analysis. Journal of Basic & Applied Zoology 65(2): 144–151. https://doi.org/10.1016/j.jobaz.2012.07.009
  • Douris V, Cameron RAD, Rodakis GC, Lecanidou R (1998) Mitochondrial phylogeography of the land snail Albinaria in Crete: long- term geolgoical and short-term vicariance effects. Evolution 52(1): 116–125. https://doi.org/10.2307/2410926
  • Dumrongrojwattana P, Tanmuangpak K (2020) The terrestrial microsnail genus Aulacospira Möllendorff, 1890 (Eupulmonata, Stylommatophora, Hypselostomatidae) in thailand with key to thai species. ZooKeys 980: 23–42. https://doi.org/10.3897/zookeys.980.54100
  • Dumrongrojwattana P, Womgkamhaeng K (2013) A new species of Sinoennea from Southern Thailand (Pulmonata: Diapheridae). Spira 5(1–2): 1–3.
  • Dumrongrojwattana P, Kamtuptim C, Wongkamhaeng K (2020) A review of Diplommatina species in eastern Thailand with the descriptions of five new species. Biodiversity Data Journal 8: 1–18. https://doi.org/10.3897/BDJ.8.e57689
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): 294–299.
  • Foon JK, Clements GR, Liew T-S (2017) Diversity and biogeography of land snails (Mollusca, Gastropoda) in the limestone hills of Perak, Peninsular Malaysia. ZooKeys 682: 1–94. https://doi.org/10.3897/zookeys.682.12999
  • Franklin JB, Fernando SA, Chalke BA, Krishnan KS (2007) Radular morphology of Conus (Gastropoda: Caenogastropoda: Conidae) from India. Molluscan Research 27(3): 111–122.
  • Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35(2): 518–522. https://doi.org/10.1093/molbev/msx281
  • Holland BS, Hadfield MG (2002) Islands within an island: Phylogeography and conservation genetics of the endangered Hawaiian tree snail Achatinella mustelina. Molecular Ecology 11(3): 365–375. https://doi.org/10.1046/j.1365-294X.2002.01464.x
  • Inkhavilay K, Sutcharit C, Bantaowong U, Chanabun R, Siriwut W, Srisonchai R, Pholyotha A, Jirapatrasilp P, Panha S (2019) Annotated checklist of the terrestrial molluscs from laos (mollusca, gastropoda). ZooKeys 834: 1–166. https://doi.org/10.3897/zookeys.834.28800
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Laidlaw FF (1949) The malayan species of Diplommatina (Cyclophoridae). Bulletin of the Raffles Museum 19: 199–215.
  • Liew T-S, Vermeulen JJ, Marzuki ME, Schilthuizen M (2014) A cybertaxonomic revision of the micro-landsnail genus Plectostoma Adam (Mollusca, Caenogastropoda, Diplommatinidae), from Peninsular Malaysia, Sumatra and Indochina. ZooKeys 393: 1–107. https://doi.org/10.3897/zookeys.393.6717
  • Maassen WJM (2001a) A Preliminary Checklist of the Non-Marine Molluscs of West-Malaysia “a Hand List”. Malacologische Contactgroep, Leiden, 155 pp.
  • Maassen WJM (2001b) Four new Diplommatinidae (Gastropoda, Prosobranchia, Diplommatinidae) from southern Thailand and northern Peninsular Malaysia. Basteria 65: 51–56.
  • Maassen WJM (2002) Remarks on the Diplommatinidae from Sumatra, Indonesia, with descriptions of eleven new species (Gastropoda, Prosobranchia). Basteria 66: 163–182.
  • Maassen WJM (2007) Notes on terrestrial molluscs of the island of Sulawesi. The genus Diplommatina (Gastropoda, Caenogastropoda, Diplommatinidae). Basteria 71: 189–208.
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop, GCE 2010. https://doi.org/10.1109/GCE.2010.5676129
  • Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J (2000) Biodiversity hotspots for conservation priorities. Nature 403(6772): 853–858. https://doi.org/10.1038/35002501
  • Nantarat N, Wade CM, Jeratthitikul E, Sutcharit C, Panha S (2014) Molecular evidence for cryptic speciation in the Cyclophorus fulguratus (Pfeiffer, 1854) species complex (Caenogastropoda: Cyclophoridae) with description of new species. PLoS ONE 9(10): e109785. https://doi.org/10.1371/journal.pone.0109785
  • Neubert E, Bouchet P (2015) The Diplommatinidae of Fiji – a hotspot of Pacific land snail biodiversity (Caenogastropoda, Cyclophoroidea). ZooKeys 487: 1–85. https://doi.org/10.3897/zookeys.487.8463
  • Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Palumbi SR (1996) Nucleic Acids II: Polymerase Chain Reaction. In: Hillis DM, Moritz C, Mable B (Eds) Molecular Systematics (2nd edn. ). Sinauer, Sunderland, 205–247.
  • Panha S, Burch JB (2001) Two new species of Diplommatina from Thailand (Prosobranchia: Diplommatinidae). The Natural History Journal of Chulalongkorn University 1: 33–37.
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Rundell RJ (2008) Cryptic diversity, molecular phylogeny and biogeography of the rock- and leaf litter-dwelling land snails of Belau (Republic of Palau, Oceania). Philosophical Transactions of the Royal Society B: Biological Sciences 363(1508): 3401–3412. https://doi.org/10.1098/rstb.2008.0110
  • Sodhi NS, Koh LP, Clements R, Wanger TC, Hill JK, Hamer KC, Clough Y, Tscharntke T, Posa MRC, Lee TM (2010) Conserving Southeast Asian forest biodiversity in human-modified landscapes. Biological Conservation 143(10): 2375–2384. https://doi.org/10.1016/j.biocon.2009.12.029
  • Steinke D, Albrecht C, Pfenninger M (2004) Molecular phylogeny and character evolution in the Western Palaearctic Helicidae s.l. (Gastropoda: Stylommatophora). Molecular Phylogenetics and Evolution 32(3): 724–734. https://doi.org/10.1016/j.ympev.2004.03.004
  • Thacker RW, Hadfield MG (2000) Mitochondrial phylogeny of extant Hawaiian tree snails (Achatinellinae). Molecular Phylogenetics and Evolution 16(2): 263–270. https://doi.org/10.1006/mpev.2000.0793
  • Thiele J (1929) Handbuch der Systematischen Weichtierkunde. Jena, Gustav Fischer, 376 pp.
  • Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22(22): 4673–4680. https://doi.org/10.1093/nar/22.22.4673
  • Tongkerd P, Sutcharit C, Panha S (2013) Two new species of micro land snails from two islands in the Andaman Sea (Prosobranchia: Diplommatinidae; Pulmonata: Pupillidae). Tropical Natural History 13(2): 65–76.
  • van Benthem Jutting WSS (1959) Catalogue of the non-marine Mollusca of Sumatra and of its satellite islands. Beaufortia 7(83): 41–191.
  • Webster NB, Van Dooren TJM, Schilthuizen M (2012) Phylogenetic reconstruction and shell evolution of the Diplommatinidae (Gastropoda: Caenogastropoda). Molecular Phylogenetics and Evolution 63(3): 625–638. https://doi.org/10.1016/j.ympev.2012.02.004
  • Wenz W (1939) Teil 1: Allgemeiner Teil und Prosobranchier. Lieferung 4. In: Schindewolf OH (Ed.) Handbuch der Paläozoologie. Band 6. Gastropoda. Borntraeger, Berlin, 481–720. https://doi.org/10.1017/s0016756800072459
  • Yamazaki K, Yamazaki M, Ueshima R (2015) Systematic review of diplommatinid land snails (Caenogastropoda, Diplommatinidae) endemic to the Palau Islands. (2) taxonomic revision of Hungerfordia species with low axial ribs. Zootaxa 3976: 001–089. https://doi.org/10.11646/zootaxa.3976.1.1

Supplementary material

Supplementary material 1 

Linked data table for pirmary biodiversity data of Diplommatina

Tuangthong Boonmachai, Elizabeth A. Bergey, Nattawadee Nantarat

Data type: occurences and phylogenetic (word document)

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (28.62 kb)
login to comment