Print
Integrative descriptions of two new Macrobiotus species (Tardigrada, Eutardigrada, Macrobiotidae) from Mississippi (USA) and Crete (Greece)
expand article infoMatteo Vecchi, Daniel Stec§
‡ University of Jyvaskyla, Jyväskylä, Finland
§ Jagiellonian University, Kraków, Poland
Open Access

Abstract

In this paper, we describe two new Macrobiotus species from Mississippi (USA) and Crete (Greece) by means of integrative taxonomy. Detailed morphological data from light and scanning electron microscopy, as well as molecular data (sequences of four genetic markers: 18S rRNA, 28S rRNA, ITS-2 and COI), are provided in support of the descriptions of the new species. Macrobiotus annewintersae sp. nov. from Mississippi belongs to the Macrobiotus persimilis complex (Macrobiotus clade B) and exhibits a unique egg processes morphology, similar only to Macrobiotus anemone Meyer, Domingue & Hinton, 2014, but mainly differs from that species by the presence of eyes, granulation on all legs, dentate lunulae on legs IV, and of bubble-like structures within the tentacular arms that are present on the distal portion of the egg processes. Macrobiotus rybaki sp. nov. from Crete belongs to the Macrobiotus clade A and is most similar to Macrobiotus dariae Pilato & Bertolani, 2004, Macrobiotus noemiae Roszkowska & Kaczmarek, 2019, Macrobiotus santoroi Pilato & D’Urso, 1976, and Macrobiotus serratus Bertolani, Guidi & Rebecchi, 1996, but differs from them mainly in the morphological details of its egg processes and chorion reticulation, but also by a number of morphometric characters. In light of the specific morphology of the egg processes of Macrobiotus annewintersae sp. nov. and Macrobiotus anemone, that are equipped with tentacular arms instead of proper terminal disc, we also provide an updated definition of the Macrobiotus persimilis complex.

Key Words

egg ornamentation, integrative taxonomy, Macrobiotus persimilis complex, molecular phylogeny, species delineation, water bears

Introduction

Tardigrades are a phylum of micrometazoans distributed worldwide, that inhabit marine and limno-terrestrial environments (Schill 2019). Currently, there are more than 1300 formally recognised tardigrade species (Guidetti and Bertolani 2005; Degma and Guidetti 2007; Degma et al. 2009–2020). In recent years, the number of tardigrade species described with integrative taxonomy has steadily increased (e.g., Surmacz et al. 2019; Bochnak et al. 2020; Kayastha et al. 2020; Tumanov et al. 2020a, b; Guidetti et al. 2021). The accumulation of data from such integrative studies allows at some point for broader examination of phylogenetic relationships within a larger group of organisms. This was the case for the family Macrobiotidae, one of the most speciose and diverse groups among tardigrades, which was recently extensively revised (Stec et al. 2021) and which is partially in focus in this study.

Faunistic and taxonomic studies on the tardigrades of North America are numerous and both local and continental species lists have been compiled (Meyer 2013; Kaczmarek et al. 2016). It is, however, clear from new species in the USA being described (see for example Nelson et al. 2020a), that we are still far from a complete knowledge of the taxonomic diversity of tardigrades in this country. In particular, the tardigrade fauna in the state of Mississippi (USA) has been investigated only once by Hinton and Meyer (2009) who reported only 9 species (from 20 samples). In contrast, the tardigrade fauna in the neighbouring states have been more thoroughly investigated and consequently more than 20 species have been recorded for Alabama, Louisiana and Arkansas, and about 100 species in Tennessee (Bartels and Nelson 2007; Meyer 2013; Kaczmarek et al. 2016; Nelson et al. 2020b).

The first information on Greek tardigrades was provided 85 years ago (Marcus 1936), and since then only a couple of studies have been explicitly devoted to assessing the diversity in this country (Durante Pasa and Maucci 1979; Maucci and Durante Pasa 1982). On the island of Crete, 28 species (from more than 150 samples) have been listed based on two sampling campaigns alone (Maucci and Durante Pasa 1982). Taking into consideration recent progress in tardigrade taxonomy and faunistic studies brought about by the integrative approach, it is more than likely that the region exhibits higher species diversity and additional sampling effort may reveal more species (Vuori et al. 2020).

In this paper, we provide descriptions of two new Macrobiotus species: Macrobiotus annewintersae sp. nov. from Mississippi (USA) and Macrobiotus rybaki sp. nov. from Crete (Greece) and show their phylogenetic position within the genus Macrobiotus. Detailed morphological and morphometric data were obtained using phase contrast and scanning electron microscopy (PCM and SEM, respectively) supported by DNA sequences for four molecular markers (three nuclear – 18S rRNA, 28S rRNA, and ITS-2 – and one mitochondrial – COI).

Materials and methods

Samples and specimens

A mixed leaf litter sample containing M. annewintersae sp. nov. was collected in a garden in a suburban area of Jackson, Mississippi (32°21'05"N, 89°56'30"W; 106 m asl; Jyväskylä University (JYU) sample code S207, Jagellonian University (JAG) sample code US.084), and a moss sample from a rock in a xeric shrubland containing M. rybaki sp. nov. was collected in Omalos, Crete (35°15'00"N, 23°49'28"E, 30 m asl; JAG sample code GR.011). The samples were examined for tardigrades using the protocol by Dastych (1980), with modifications described in detail in Stec et al. (2015). Live animals and eggs of M. annewintersae sp. nov. were placed into culture. Specimens were reared in plastic Petri dishes according to the protocol by Stec et al. (2015). Tardigrades were fed ad libitum with unicellular freshwater algae (Chlorococcum sp. and Chlorella sp.; 1:1, Sciento, UK) and Lecane inermis Bryce, 1892 (Rotifera) and kept at 16C under a 2:22 light:dark photoperiod.

In order to perform the taxonomic analysis, animals and eggs were either extracted from culture (M. annewintersae ssp. nov.), or directly from the sample (M. rybaki sp. nov.) and split into several groups for specific analyses i.e., morphological analysis in PCM and SEM, as well as DNA sequencing (for details see sections “Material examined” provided below in the results section for each species description).

Microscopy and imaging

Specimens for light microscopy were mounted on microscope slides in a small drop of Hoyer’s medium and secured with a cover slip, following protocol by Morek et al. (2016). Slides were examined under an Olympus BX53 light microscope with PCM, associated with an Olympus DP74 digital camera or under a Zeiss Axioscope A2 light microscope associated with a MiniVID digital camera. Immediately after mounting, the specimens were checked under PCM for the presence of males and females in each of the studied populations, as the spermatozoa in testes and vasa deferentia are visible for several hours after mounting (Coughlan and Stec 2019; Coughlan et al. 2019). To obtain clean and extended specimens for SEM analysis, tardigrades were processed according to the protocol by Stec et al. (2015). Specimens were examined under high vacuum in a Versa 3D DualBeam SEM at the ATOMIN facility of the Jagiellonian University, Kraków, Poland or in a Raith e-LINE E-beam SEM at Nanoscience Center of University of Jyväskylä, Jyväskylä, Finland. All figures were assembled in Corel Photo-Paint X6, ver. 16.4.1.1281. For structures that could not be satisfactorily focused in a single light microscope photograph, a stack of 2–6 images were taken with an equidistance of ca. 0.2 μm and assembled manually into a single deep-focus image in Corel Photo-Paint X6.

Morphometrics and morphological nomenclature

All measurements are given in micrometres (μm). Sample size was adjusted following the recommendations by Stec et al. (2016). Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the posterior end of the body, excluding the hind legs. The terminology used to describe oral cavity armature and eggshell morphology follows Michalczyk and Kaczmarek (2003) and Kaczmarek and Michalczyk (2017). Macroplacoid length sequence is given according to Kaczmarek et al. (2014). Buccal tube length and the level of the stylet support insertion point were measured according to Pilato (1981). The pt index is the ratio of the length of a given structure to the length of the buccal tube expressed as a ratio (Pilato 1981). Measurements of buccal tube widths, heights of claws and eggs follow Kaczmarek and Michalczyk (2017). Morphometric data were handled using the “Parachela” ver. 1.7 template available from the Tardigrada Register (Michalczyk and Kaczmarek 2013). The raw morphometric data are provided as Suppl. materials 1, 2. Tardigrade taxonomy follows Bertolani et al. (2014) and Stec et al. (2021). Thorpe´s normalisation was performed with the R software (R Core Team 2020) on the morphometric traits following Bartels et al. (2011) (SM.03).

Additional material

Individuals of Macrobiotus aff. polonicus (JYU sample code S165; 58°52'42"N, 17°55'60"E; 23 m asl: Nynäshamn, Sweden; lichen growing on rock on a roadside in a coastal area; coll. Sept. 2019 by MV and Sara Calhim) were genotyped for all the four markers and added to the phylogenetic reconstruction to increase the number of species included in the phylogenetic analysis. Photographs of eggs from the type series of Macrobious anemone Meyer, Domingue & Hinton, 2014 (slides 9551 and 9552) were kindly provided by Harry A. Meyer (McNeese State University, Louisiana, USA). Photographs of eggs from the type series of M. dariae Pilato & Bertolani, 2004 (slides PC45s1 and PC45s3) and M. serratus Bertolani, Guidi & Rebecchi, 1996 (slides C1907s17 and C1907s30) from the Bertolani collection were kindly provided by Roberto Guidetti (University of Modena and Reggio Emilia, Italy). Additional photos of the paratypes and eggs of Macrobiotus andinus Maucci, 1988 were kindly taken for us by Witold Morek and Piotr Gąsiorek (Jagiellonian University, Poland) from the Maucci collection (Natural History Museum of Verona).

Genotyping

DNA was extracted from individual animals following a Chelex 100 resin (BioRad) extraction method by Casquet et al. (2012) with modifications described in detail in Stec et al. (2020a). Each specimen was mounted in water and examined under a light microscope prior to DNA extraction. We sequenced four DNA fragments, three nuclear (18S rRNA, 28S rRNA, ITS2) and one mitochondrial (COI). All fragments were amplified and sequenced according to the protocols described in Stec et al. (2020a); primers with original references are listed in Table 1. Sequencing products were read with the ABI 3130xl sequencer at the Molecular Ecology Lab, Institute of Environmental Sciences of the Jagiellonian University, Kraków, Poland. Sequences were processed in MEGA7 (Kumar et al. 2016) and submitted to NCBI GenBank (Table 2).

Table 1.

Primers with their original references used for amplification of the four DNA fragments sequenced in the study.

DNA marker Primer name Primer direction Primer sequence (5’-3’) Primer source
18S rRNA 18S_Tar_Ff1 forward AGGCGAAACCGCGAATGGCTC Stec et al. (2017a)
18S_Tar_Rr1 reverse GCCGCAGGCTCCACTCCTGG
28S rRNA 28S_Eutar_F forward ACCCGCTGAACTTAAGCATAT Gąsiorek et al. (2018)
28SR0990 reverse CCTTGGTCCGTGTTTCAAGAC Mironov et al. (2012)
ITS-2 ITS2_Eutar_Ff forward CGTAACGTGAATTGCAGGAC Stec et al. (2018a)
ITS2_Eutar_Rr reverse TCCTCCGCTTATTGATATGC
COI LCO1490-JJ forward CHACWAAYCATAAAGATATYGG Astrin and Stüben (2008)
HCO2198-JJ reverse AWACTTCVGGRTGVCCAAARAATCA

Phylogenetic analysis

The phylogenetic analyses were conducted using concatenated 18S rRNA+28S rRNA+ITS-2+COI sequences from Macrobiotidae, with Richtersius coronifer (Richters, 1903) and Dactylobiotus parthenogeneticus Bertolani, 1982 as outgroups. GenBank accession numbers of all sequences used in the analysis are listed in Table 2. Only species/populations with at least 3 markers were included in the analysis.

Table 2.

GenBank accession numbers of sequences downloaded from GenBank and used in the present study. Newly generated sequences are bolded.

18S 28S COI ITS2 Reference
Dactylobiotus parthenogeneticus MT373693 MT373699 MT373803 MT374190 Pogwizd and Stec (2020)
Macrobiotus aff. pseudohufelandi PL MN888373 MN888358 MN888325 MN888345 Stec et al. (2021)
Macrobiotus aff. pseudohufelandi ZA MN888374 MN888359 MN888326 MN888346 Stec et al. (2021)
Macrobiotus aff. polonicus SE MW588026 MW588032 MW593929 MW588020 This study
MW588027 MW588033 MW593930 MW588021
Macrobiotus annewintersae sp. nov. MW588024 MW588030 MW593927 MW588018 This study
MW588025 MW588031 MW593928 MW588019
Macrobiotus basiatus MT498094 MT488397 MT502116 MT505165 Nelson et al. (2020)
Macrobiotus caelestis MK737073 MK737071 MK737922 MK737072 Coughlan et al. (2019)
Macrobiotus canaricus MH063925 MH063934 MH057765 MH063928 Stec et al. (2018b)
MH057766 MH063929
Macrobiotus cf. pallarii FI MN888366 MN888352 MN888312 MN888343 Stec et al. (2021)
MN888342
Macrobiotus cf. pallarii ME MN888365 MN888351 MN888316 MN888335 Stec et al. (2021)
MN888336
Macrobiotus cf. pallarii PL MN888367 MN888353 MN888313 MN888341 Stec et al. (2021)
MN888314
Macrobiotus cf. pallarii US MN888368 MN888354 MN888315 MN888339 Stec et al. (2021)
MN888340
Macrobiotus cf. recens MH063927 MH063936 MH057768 MH063932 Stec et al. (2018b)
MH057769 MH063933
Macrobiotus crustulus MT261912 MT261903 MT260371 MT261907 Stec et al. (2020c)
Macrobiotus engbergi MN443039 MN443034 MN444824 MN443036 Stec et al. (2020b)
MN444825 MN443037
MN444826
Macrobiotus glebkai MW247177 MW247176 MW246134 MW247180 Kiosya et al. (2021)
Macrobiotus hannae MH063922 MH063924 MH057764 MH063923 Nowak and Stec (2018)
Macrobiotus kamilae MK737070 MK737064 MK737920 MK737067 Coughlan and Stec (2019)
MK737921
Macrobiotus macrocalix MH063926 MH063935 MH057767 MH063931 Stec et al. (2018b)
Macrobiotus noongaris MK737069 MK737063 MK737919 MK737065 Coughlan and Stec (2019)
MK737066
Macrobiotus papei MH063881 MH063880 MH057763 MH063921 Stec et al. (2018c)
Macrobiotus paulinae KT935502 KT935501 KT951668 KT935500 Stec et al. (2015)
Macrobiotus polonicus AT MN888369 MN888355 MN888317 MN888337 Stec et al. (2021)
MN888318 MN888338
MN888319
Macrobiotus polonicus SK MN888370 MN888356 MN888320 MN888332 Stec et al. (2021)
MN888321 MN888333
MN888334
Macrobiotus polypiformis KX810008 KX810009 KX810011 KX810010 Roszkowska et al. (2017)
KX810012
Macrobiotus porifini MT241900MT241901 MT241897MT241898 MT246659 Kuzdrowska et al. (2021)
MT246661
Macrobiotus rybaki sp. nov. MW588028 MW588034 MW593931 MW588022 This study
MW588029 MW588035 MW593932 MW588023
Macrobiotus scoticus KY797265 KY797266 KY797267 KY797268 Stec et al. (2017b)
Macrobiotus shonaicus MG757132 MG757133 MG757136 MG757134 Stec et al. (2018d)
MG757137 MG757135
Macrobiotus sottilei MW247178 MW247175 MW246133 MW247179 Kiosya et al. (2021)
Macrobiotus vladimiri MN888375 MN888360 MN888327 MN888347 Stec et al. (2021)
Macrobiotus wandae MN435112 MN435116 MN482684 MN435120 Kayastha et al. (2020a)
Mesobiotus harmsworthi MH197146 MH197264 MH195150 MH197154 Kaczmarek et al. (2018a)
Mesobiotus radiatus MH197153 MH197152 MH195147 MH197267 Stec et al. (2018e)
Mesobiotus romani MH197158 MH197151 MH195149 MH197150 Roszkowska et al. (2018)
Minibiotus ioculator MT023999 MT024041 MT023412 MT024000 Stec et al. (2020a)
Minibiotus pentannulatus MT023998 MT024042 MT023413 MT024001 Stec et al. (2020a)
Paramacrobiotus areolatus MH664931 MH664948 MH675998 MH666080 Stec et al. (2020d)
Paramacrobiotus fairbanksi MH664942 MH664959 MH676012 MH666091 Stec et al. (2020d)
Paramacrobiotus lachowskae MF568532 MF568533 MF568534 MF568535 Stec et al. (2018f)
Paramacrobiotus tonollii MH664946 MH664963 MH676018 MH666096 Stec et al. (2020d)
Richtersius coronifer MH681760 MH681757 MH676053 MH681763 Stec et al. (2020e)
Sisubiotus spectabilis FI MN888371 MN888357 MN888322 MN888331 Stec et al. (2021)
MN888323
Sisubiotus spectabilis NO MN888372 MN888364 MN888324 MN888344 Stec et al. (2021)
Tenuibiotus danilovi MN888377 MN888362 MN888329 MN888349 Stec et al. (2021)
Tenuibiotus tenuiformis MN888378 MN888363 MN888330 MN888350 Stec et al. (2021)
Tenuibiotus zandrae MN443040 MN443035 MN444827 MN443038 Stec et al. (2020b)

The 18S rRNA, 28S rRNA and ITS-2 sequences were aligned using MAFFT ver. 7 (Katoh et al. 2002; Katoh and Toh 2008) with the G-INS-i method (thread=4, threadtb=5, threadit=0, reorder, adjust direction, any symbol, max iterate=1000, retree 1, global pair input). The COI sequences were aligned according to their amino acid sequences (translated using the invertebrate mitochondrial code) with the MUSCLE algorithm (Edgar 2004) in MEGA7 with default settings (i.e., all gap penalties=0, max iterations=8, clustering method=UPGMB, lambda=24). Alignments were visually inspected and trimmed in MEGA7. Model selection and phylogenetic reconstructions were undertaken using the CIPRES Science Gateway (Miller et al. 2010). Model selection was performed for each alignment partition (6 in total: 18S rRNA, 28S rRNA, ITS-2 and three COI codons) using PartitionFinder2 (Lanfear et al. 2016), partitions and model selection process together with results are contained in Suppl. material 4. Bayesian inference (BI) phylogenetic reconstruction was performed using MrBayes v3.2.6 (Ronquist et al. 2012) without BEAGLE. Two runs (one cold chain and three heated chains each) of 20 million generations were used with a burn-in of 2 million generations, sampling a tree every 1000 generations. Posterior distribution sanity was checked using Tracer v1.7 (Rambaut et al. 2018). The MrBayes input file with the input alignment is available as Suppl. material 5, and the MrBayes output consensus tree is available as Suppl. material 6. The phylogenetic tree was visualised with FigTree v1.4.4 (Rambaut 2007) and the image was edited with Inkscape 0.92.3 (Bah 2011).

Results

Taxonomic account

Phylum: Tardigrada Doyère, 1840

Class: Eutardigrada Richters, 1926

Order: Parachela Schuster et al., 1980 (restored by Morek et al. 2020)

Superfamily: Macrobiotoidea Thulin, 1928 (in Marley et al. 2011)

Family: Macrobiotidae Thulin, 1928

Genus: Macrobiotus Schultze C.A.S., 1834

Macrobiotus annewintersae Vecchi & Stec, sp. nov.

Tables 3, 4, Figures 1, 2, 3, 4, 5, 6, 7, 8, Suppl. material 1

Etymology

We dedicate this species to MV friend and colleague Dr. Anne Winters, evolutionary ecologist, who collected the sample in which the new species was found.

Material examined

146 animals and 56 eggs. Specimens mounted on microscope slides in Hoyer’s medium (93 animals + 38 eggs), fixed on SEM stubs (51+18), and processed for DNA sequencing (2+0).

Type locality

32°21'05"N, 89°56'30"W; 106 m asl: suburban area of Jackson, Mississippi, USA; mixed leaf litter on ground; coll. December 2019 by Anne Winters.

Type depositories

Holotype ♀ (slide US.084.01 with 10 paratypes) and 63 paratypes (slides: US.084.*, where the asterisk can be substituted by any of the following numbers: 02–05) and 20 eggs (slides US.084.*: 06–08) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University (Gronostajowa 9, 30-387, Kraków, Poland). Additional paratypes (71 animals + 29 eggs) (slides: S207_SL*: 1–15; SEM stubs: S207_Stub*:1–4) are deposited at the Department of Biological and Environmental Sciences, University of Jyväskylä (Survontie 9C, 40500, Jyväskylä, Finland).

Description of the new species

Animals (measurements and statistics in Table 3):

Table 3.

Measurements [in µm] of selected morphological structures of individuals of Macrobiotus annewintersae sp. nov. mounted in Hoyer’s medium (N–number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD–standard deviation).

Character N Range Mean Sd Holotype
µm pt µm pt µm pt µm Pt
Body length 29 287 441 934 1226 371 1074 46 84 434 1226
Buccal tube
Buccal tube length 28 27.1 40.4 34.3 3.1 35.4
Stylet support insertion point 28 21.2 32.0 76.8 81.6 27.2 79.4 2.4 1.3 27.5 77.7
Buccal tube external width 29 3.4 6.1 12.5 17.0 4.7 13.8 0.6 1.0 5.4 15.3
Buccal tube internal width 29 1.9 4.5 6.8 11.5 3.2 9.4 0.6 1.1 3.3 9.3
Ventral lamina length 22 16.0 26.1 49.4 64.5 20.1 58.8 2.2 3.0 21.9 61.9
Placoid lengths
Macroplacoid 1 28 6.3 10.3 20.9 28.9 8.3 24.4 1.0 1.8 9.4 26.6
Macroplacoid 2 30 3.6 6.8 12.6 18.5 5.3 15.2 0.8 1.6 5.6 15.8
Microplacoid 30 1.6 4.1 4.7 11.5 2.6 7.7 0.6 1.6 2.9 8.2
Macroplacoid row 26 10.9 17.6 38.8 49.4 14.8 43.6 1.8 2.8 16.6 46.9
Placoid row 26 13.7 22.3 48.8 62.6 18.5 54.5 2.2 3.6 20.7 58.5
Claw 1 heights
External primary branch 24 7.4 11.0 22.7 30.4 9.5 27.6 0.8 2.0 10.4 29.4
External secondary branch 22 5.7 8.7 18.6 24.2 7.6 21.6 0.7 2.0 8.5 24.0
Internal primary branch 25 7.3 10.5 21.8 28.4 8.7 25.5 0.7 1.9 9.6 27.1
Internal secondary branch 23 5.4 8.6 16.7 22.5 7.0 20.1 0.7 1.4 7.5 21.2
Claw 2 heights
External primary branch 26 7.2 11.6 25.6 32.5 10.0 29.1 1.0 1.9 11.0 31.1
External secondary branch 25 6.3 9.6 18.9 26.3 8.0 23.0 0.8 2.0 9.3 26.3
Internal primary branch 28 7.0 11.6 23.8 30.8 9.4 27.1 0.9 1.9 9.8 27.7
Internal secondary branch 26 5.4 9.0 15.6 24.3 7.1 20.5 0.9 2.1 8.6 24.3
Claw 3 heights
External primary branch 25 8.3 11.4 25.8 31.0 9.9 28.8 0.9 1.7 10.9 30.8
External secondary branch 24 5.9 9.3 19.1 27.2 7.8 22.6 1.0 2.2 9.3 26.3
Internal primary branch 26 7.0 10.7 20.3 28.8 9.0 26.3 0.9 1.8 9.4 26.6
Internal secondary branch 24 5.2 8.4 16.5 23.1 7.1 20.7 0.9 1.8 7.7 21.8
Claw 4 heights
Anterior primary branch 26 8.2 12.5 25.0 35.3 10.4 30.6 1.1 2.5 12.5 35.3
Anterior secondary branch 25 5.2 9.4 14.3 26.3 7.7 22.7 0.8 2.5 9.3 26.3
Posterior primary branch 25 9.2 14.5 29.5 37.6 11.5 33.5 1.1 2.4 12.7 35.9
Posterior secondary branch 23 6.9 10.4 19.9 31.6 8.4 24.7 0.9 2.8 ? ?

In live animals, body translucent in smaller specimens and opaque whitish in larger animals; transparent after fixation in Hoyer’s medium (Figure 1). Eyes present in live animals and after fixation in Hoyer’s medium. Small roundish cuticular pores on the dorsal and lateral cuticle, as well as on the external cuticle of all legs (0.2–0.6 μm in diameter), visible under both PCM and SEM (Figures 1B, C, 2D). On the dorsal surface, pores are absent between cuticle folds and arranged in loose belts (Figure 1C). Pores sparse on the ventral surface and visible only under SEM (Figure 8C). Patches of fine granulation, on the external surface of legs I–III as well as on the dorsal and dorso-lateral sides of legs IV, visible in PCM (Figure 2A, C) and SEM (Figure 2D). A pulvinus is present on the internal surface of legs I–III (Figure 2B, E).

Table 4.

Measurements [in µm] of selected morphological structures of the eggs of Macrobiotus annewintersae sp. nov. mounted in Hoyer’s medium (N–number of eggs/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD–standard deviation).

Character N Range Mean Sd
egg bare diameter 20 59.8 76.7 66.1 3.7
Egg full diameter 20 69.8 87.1 75.7 4.6
Process height 63 4.2 7.3 5.8 0.7
Process base width 63 2.4 5.9 4.1 0.7
Process base/height ratio 63 52% 100% 71% 10%
Terminal disc width 63 2.8 6.7 4.4 0.9
Inter-process distance 63 2.3 6.9 4.2 0.9
Number of processes on the egg circumference 20 21 28 24.4 1.7
Figure 1. 

Macrobiotus annewintersae sp. nov. – habitus and cuticular pores: A. Dorso-ventral view of the body (Holotype ♀;, PCM); B, C. Cuticular pores on the dorsal part of the body under PCM and under SEM, respectively. Arrowheads indicate pores and empty arrows indicate places on dorsal cuticle without pores. Scale bars in μm.

Figure 2. 

Macrobiotus annewintersae sp. nov. – cuticular structures on legs: A. External granulation on leg III under PCM; B. A cuticular bulge (pulvinus) on the internal surface of leg III under PCM; C. Granulation on leg IV under PCM; D. External granulation on leg III under SEM; E. A cuticular bulge (pulvinus) on the internal surface of leg III under SEM. Filled flat arrowheads indicate the granulation patch, empty flat arrowheads indicate pulvinus and filled indented arrowheads indicate muscle attachments. C assembled from several photos. Scale bars in μm.

Claws Y-shaped, of the hufelandi type. Primary branches with distinct accessory points, a common tract, and an evident stalk connecting the claw to the lunula (Figure 3). The lunulae I–III are smooth (Figure 3A, C), whereas lunulae IV are dentate (Figure 3B, D). A divided cuticular bar with double muscle attachments are poorly visible under PCM (Figure 3A).

Figure 3. 

Macrobiotus annewintersae sp. nov. – claws: A, B. Claws III and IV, respectively, under PCM; C, D. Claws III and IV, respectively, under SEM. Filled indented arrowheads indicate double muscle attachments under the claws, empty indented arrowheads indicate a faintly visible divided cuticular bar. A and B assembled from several photos. Scale bars in μm.

Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type (Figure 4) with ventral lamina and ten peribuccal lamellae. The stylet furcae typically-shaped, the basal portion is enlarged and has two caudal branches with thickened, swollen, rounded apices. Under PCM, the oral cavity armature is of the patagonicus type, i.e., with only the second and third bands of teeth visible (Figure 4B, C). However, under SEM the first band of teeth is visible and composed of one row of very small cones situated anteriorly in the oral cavity, just behind the bases of the peribuccal lamellae (Figure 5). The second band of teeth is situated between the ring fold and the third band of teeth and composed of 3–4 rows of teeth visible in PCM as granules (Figure 4B, C). The third band of teeth is divided into a dorsal (Figure 4B) and a ventral portion (Figure 4C). Under PCM, the dorsal teeth are seen as three distinct transverse ridges whereas the ventral teeth appear as two separate lateral transverse ridges between which one big tooth (sometimes circular in PCM) is visible (Figure 4B, C).

Figure 4. 

Macrobiotus annewintersae sp. nov. – buccal apparatus and the oral cavity armature under PCM: A. Dorso-ventral view of the entire buccal apparatus; B, C. Oral cavity armature in dorsal and ventral view, respectively; D, E. Placoid morphology in dorsal and ventral view, respectively. Empty flat arrowheads indicate the second band of teeth, filled indented arrowheads indicate the third band of teeth in the oral cavity, and empty indented arrowheads indicate central constriction in the first macroplacoid and subterminal constriction in the second macroplacoid. A, D and E assembled from several photos. Scale bars in μm.

Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a drop-shaped microplacoid (Figure 4A, D, E). The macroplacoid length sequence is 2<1. The first and the second macroplacoid have a central and a subterminal constriction, respectively (Figure 4D, E).

Figure 5. 

Macrobiotus annewintersae sp. nov. – anterior view of the mouth opening under SEM. Filled flat arrowhead indicates the first band of teeth. Scale bar in μm.

Eggs (measurements and statistics in Table 4):

The surface between processes is of the persimilis type, i.e., with a continuous smooth chorion, never with pores or reticulum (Figures 6, 7). Under PCM the surface between the processes is covered with wrinkles that appear as dark thickenings/striae, whereas under SEM the surface appears clearly wrinkled (Figures 6, 7). Processes are of a modified hufelandi type (Figures 6, 7). The proper terminal disc is absent and instead 2–8 thick tentacular arms (typically 5–6) are present in the distal part of the process (Figures 6, 7). The tentacular arms present bubble-like structures (visible in PCM). Under SEM, each tentacular arm is distally divided into many irregular digitations that are sometime covered with micro-granulation (Figure 7C–F). Also, under SEM micro-pores can be seen on the egg surface between the processes and around the process bases (Figure 7C, E).

Figure 6. 

Macrobiotus annewintersae sp. nov. – egg chorion morphology under PCM: A, B. Egg surface; C, D. Midsection of the processes. Filled flat arrowheads indicate bubble-like structures within tentacular arms in the distal portion of the egg processes and empty flat arrowheads indicate dark thickenings/striae on the egg surface between processes. Scale bars in μm.

Figure 7. 

Macrobiotus annewintersae sp. nov. – egg chorion morphology under SEM: A, B. Entire egg; C–E. Details of the egg processes and egg surface between them; F. Details of the tentacular arms in the distal portion of each egg process. Filled indented arrowheads indicate micropores and empty indented arrowheads indicate lobes in tentacular arms covered by micro-granulation. Scale bars in μm.

Reproduction / Sexual dimorphism. The species is dioecious. Spermathecae in females as well as testis in males, clearly visible under PCM up to 24 hours after mounting in Hoyer’s medium, have been found to be filled with spermatozoa (Figure 8A, B). The species exhibits secondary sexual dimorphism in the form of clearly visible lateral gibbosities on the hind legs in males (Figure 8B, C).

Figure 8. 

Macrobiotus annewintersae sp. nov. – reproduction: A. Female under PCM; B. Male under PCM; C. Male under SEM. Filled indented arrowhead indicates spermathecae filled with spermatozoa, empty indented arrowhead indicates male’s testis, arrows indicate lateral gibbosities on legs IV and filled flat arrowhead indicates cuticular pore on the ventral side of the body. Scale bars in μm.

DNA sequences

18S rRNA: GenBank: MW588024MW588025; 659 and 664 bp long.

28S rRNA: GenBank: MW588030MW588031; 679 and 703 bp long.

ITS-2: GenBank: MW588018MW588019; 298 bp long.

COI: GenBank: MW593927MW593928; 532 and 535 bp long.

Phenotypic differential diagnosis. By having an egg chorion of the persimilis type (smooth or wrinkled chorion) and by having thick tentacular arms instead of a proper terminal disc on the distal part of egg processes, M. annewintersae sp. nov. resembles only one species: Macrobiotus anemone Meyer, Domingue & Hinton, 2014 from USA. However, the new species differs specifically from:

  1. M. anemone by having eyes (absent in M. anemone), by the presence of granulation on all legs (absent in M. anemone), by having the oral cavity armature (OCA) of the patagonicus type (maculatus type – only the third band of teeth visible under light microscope – in M. anemone), by the presence of dentate lunulae in legs IV (smooth lunulae in legs IV in M. anemone), by having the thick tentacular arms in the distal part of the processes filled with bubble-like structures (tentacular arms solid in M. anemone, Figure 17) and by lacking a cavity between the process trunk and tentacular arms that appears in PCM as a clearly refracting dot (the cavity present in M. anemone, Figure 17).

Macrobiotus rybaki Stec & Vecchi, sp. nov.

Tables 5, 6, Figures 9, 10, 11, 12, 13, 14, 15, 16, SM.02

Etymology

We dedicate this species to the singer, composer, musician, actor and the 2009 Eurovision Song Contest winner, Alexander Rybak.

Material examined

173 animals and 37 eggs. Specimens mounted on microscope slides in Hoyer’s medium (156 animals + 32 eggs), fixed on SEM stubs (15+5), and processed for DNA sequencing (2+0).

Type locality

35°15'00"N, 23°49'28"E; 30 m asl: Omalos, Crete, Greece; moss on rock in a xeric shrubland; coll. June 2015 by Małgorzata Mitan and Małgorzata Osielczak.

Type depositories

Holotype ♂ (slide GR.011.11 with 11 paratypes) and 160 paratypes (slides: GR.011.*, where the asterisk can be substituted by any of the following numbers: 02–08, 10–13, 15–16; SEM stub: 18.10) and 37 eggs (slides GR.011.*: 01, 09, 14; SEM stub: 18.10) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University (Gronostajowa 9, 30-387, Kraków, Poland).

Description of the new species

Animals (measurements and statistics in Table 5):

Table 5.

Measurements [in µm] of selected morphological structures of individuals of Macrobiotus rybaki sp. nov. mounted in Hoyer’s medium (N–number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD–standard deviation).

Character N Range Mean Sd Holotype
µm pt µm pt µm pt µm pt
Body length 30 320 520 915 1190 424 1054 39 67 436 1093
Buccal tube
Buccal tube length 30 34.9 44.4 40.2 2.3 39.9
Stylet support insertion point 30 25.8 33.1 73.0 75.4 29.7 73.9 1.7 0.6 30.1 75.4
Buccal tube external width 30 4.4 6.6 12.3 15.6 5.5 13.7 0.5 0.8 5.1 12.8
Buccal tube internal width 30 2.8 5.5 7.0 13.3 4.6 11.4 0.5 1.0 2.8 7.0
Ventral lamina length 27 21.5 28.9 59.4 65.9 25.6 63.7 1.8 1.7 24.5 61.4
Placoid lengths
Macroplacoid 1 30 8.2 13.1 23.5 30.1 10.8 26.8 1.1 1.8 9.5 23.8
Macroplacoid 2 30 5.8 8.0 15.3 19.5 6.9 17.1 0.6 1.1 6.2 15.5
Microplacoid 30 1.9 3.8 4.3 9.2 2.7 6.8 0.4 1.0 2.5 6.3
Macroplacoid row 30 15.4 22.1 42.6 51.2 18.7 46.5 1.7 2.5 17.0 42.6
Placoid row 30 18.2 25.2 51.1 61.0 22.1 55.0 1.8 2.7 20.4 51.1
Claw 1 heights
External primary branch 27 10.1 15.7 26.8 36.2 12.5 31.0 1.2 2.1 12.2 30.6
External secondary branch 26 8.0 12.1 21.9 28.9 9.9 24.5 1.0 1.9 9.4 23.6
Internal primary branch 27 9.4 14.8 26.1 33.9 11.9 29.5 1.2 1.8 11.8 29.6
Internal secondary branch 27 7.2 10.8 18.6 26.9 9.2 22.8 1.1 2.1 9.0 22.6
Claw 2 heights
External primary branch 30 10.5 15.0 30.1 37.4 13.1 32.7 1.0 1.7 12.4 31.1
External secondary branch 28 8.2 12.8 22.9 31.4 10.5 26.0 1.1 2.1 9.9 24.8
Internal primary branch 30 10.1 14.6 26.6 35.4 12.6 31.3 1.0 1.9 11.8 29.6
Internal secondary branch 30 7.5 11.8 19.4 29.6 9.9 24.6 1.1 2.5 8.5 21.3
Claw 3 heights
External primary branch 28 11.5 15.8 29.6 38.2 13.4 33.5 1.2 2.2 12.3 30.8
External secondary branch 25 8.5 13.3 23.2 32.1 10.6 26.7 1.2 2.5 9.8 24.6
Internal primary branch 29 10.6 15.2 28.9 36.2 12.9 32.2 1.1 1.9 11.7 29.3
Internal secondary branch 29 7.2 11.8 20.6 29.8 10.0 24.9 1.1 2.3 9.4 23.6
Claw 4 heights
Anterior primary branch 28 12.5 17.4 34.2 44.9 15.7 39.2 1.4 3.2 15.4 38.6
Anterior secondary branch 23 7.7 12.9 20.6 31.4 10.7 26.6 1.4 3.2 11.2 28.1
Posterior primary branch 26 13.2 18.8 35.4 46.3 16.8 41.8 1.4 3.1 17.3 43.4
Posterior secondary branch 25 9.0 13.1 24.1 33.8 11.7 29.2 1.1 2.6 11.9 29.8

In live animals, body translucent in smaller specimens and opaque whitish in larger animals; transparent after fixation in Hoyer’s medium (Figure 9A). Eyes present in live animals and after fixation in Hoyer’s medium. Elliptical cuticular pores (0.6–1.5 μm in length) present all over the body and clearly visible under both PCM and SEM (Figures 9B–D, 10). Patches of fine granulation on the external surface of legs I–III as well as on the dorsal and dorso-lateral sides of legs IV clearly visible under both PCM and SEM (Figure 10A, B, E, F). A pulvinus is present on the internal surface of legs I–III (Figure 10C, D).

Figure 9. 

Macrobiotus rybaki sp. nov. – habitus and cuticular pores: A. Dorso-ventral view of the body (Holotype ♂; Hoyer’s medium, PCM); B. Cuticular pores on the dorsal part of the body under SEM; C, D. Cuticular pores on the dorsal and ventral part of the body under PCM, respectively. Filled arrows indicate lateral gibbosities. Arrowheads indicate elliptical pores. Scale bars in μm.

Claws Y-shaped, of the hufelandi type. Primary branches with distinct accessory points, a common tract, and an evident stalk connecting the claw to the lunula (Figure 11). The lunulae I–III are smooth (Figure 11A, D, E), whereas lunulae IV are dentate (Figure 11B, C, F). A divided cuticular bar and doubled muscle attachments are visible under PCM (Figures 10C, D, 11A, D, E).

Figure 10. 

Macrobiotus rybaki sp. nov. – cuticular structures on legs: A, B. External granulation on leg III and II under PCM and SEM, respectively; C, D. A cuticular bulge (pulvinus) on the internal surface of legs III under PCM and SEM, respectively; E, F. Granulation on legs IV under PCM and SEM, respectively. Filled flat arrowheads indicate the granulation patch, empty flat arrowheads indicate pulvinus and filled indented arrowheads indicate muscle attachments. A and E assembled from several photos. Scale bars in μm.

Figure 11. 

Macrobiotus rybaki sp. nov. – claws: A, B. Claws III and IV, respectively, under PCM; C. Magnification of lunulae IV of a different specimen; D–F. Claws II, III and IV respectively, under SEM. Filled indented arrowheads indicate double muscle attachments under the claws, empty indented arrowheads indicate a divided cuticular bar. A and B assembled from several photos. Scale bars in μm.

Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type (Figure 12), with ventral lamina and ten peribuccal lamellae (Figure 13A). The stylet furcae typically-shaped, the basal portion is enlarged and has two caudal branches with thickened, swollen, rounded apices. Under PCM, the oral cavity armature is of the patagonicus type, i.e., with only the second and third bands of teeth visible (Figure 12B, C). However, under SEM the first band of teeth is visible as a row of irregularly distributed small teeth situated anteriorly in the oral cavity, just behind the bases of the peribuccal lamellae (Figure 13A, B). The second band of teeth is situated between the ring fold and the third band of teeth and comprised of 3–4 rows of teeth faintly visible in PCM (Figure 12B, C) and visible as cones in SEM (Figure 13A). Teeth of the second band are larger than those in the first band. The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figures 12B, C, 13A, B). The third band of teeth is divided into a dorsal and the ventral portion. Under both PCM and SEM, the dorsal teeth are seen as three distinct transverse ridges (Figures 12B, 13A). The ventral teeth appear as two separate lateral transverse ridges between which one conical medial tooth (roundish in PCM) is visible (Figures 12C, 13B). Lateral cribrose area present in the buccal tube behind the third band of teeth (Figure 13B). Pharyngeal bulb spherical, with triangular apophyses, three anterior cuticular spikes (typically only two are visible in any given plane), two rod-shaped macroplacoids and a drop-shaped microplacoid (Figures 12A, D, E). The macroplacoid length sequence is 2<1. The first macroplacoid has a weak central constriction, whereas the second is weakly constricted only subterminally (Figures 12D, E).

Figure 12. 

Macrobiotus rybaki sp. nov. – buccal apparatus and the oral cavity armature under PCM: A. Dorso-ventral view of the entire buccal apparatus; B, C. Oral cavity armature in dorsal and ventral view, respectively; D, E. Placoid morphology in dorsal and ventral view, respectively. Empty flat arrowheads indicate the second band of teeth, filled indented arrowheads indicate the third band of teeth in the oral cavity, empty indented arrowheads indicate central constriction in the first macroplacoid and subterminal constriction in the second macroplacoid and arrows indicate cuticular spikes between end of the buccal tube and anterior portion of the bulbus. A, D, E assembled from several photos. Scale bars in μm.

Eggs (measurements and statistics in Table 6):

Table 6.

Measurements [in µm] of selected morphological structures of the eggs of Macrobiotus rybaki sp. nov. mounted in Hoyer’s medium (N–number of eggs/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD–standard deviation).

Character N Range Mean Sd
Egg bare diameter 14 68.7 93.4 76.2 7.6
Egg full diameter 14 83.6 107.9 94.1 7.9
Process height 42 6.7 13.4 9.2 1.5
Process base width 42 4.4 9.6 6.9 1.0
Process base/height ratio 42 52% 99% 76% 12%
Terminal disc width 42 1.3 4.2 2.3 0.7
Inter-process distance 42 1.4 4.5 2.7 0.8
Number of processes on the egg circumference 14 25 34 28.1 3.0
Figure 13. 

Macrobiotus rybaki sp. nov. – anterior view of the oral cavity armature under SEM: A, B. Dorsal and ventral view, respectively. Filled flat arrowheads indicate the first band of teeth, empty flat arrowhead indicates the second band of teeth, filled indented arrowheads indicate the third band of teeth in the oral cavity. Scale bars in μm.

The surface between processes is of the hufelandi type, i.e., covered with a reticulum (Figures 14A, B, 15A–E). Peribasal meshes of slightly larger diameter compared to interbasal meshes (Figures 14A, B, 15A–D). Typically, the reticulation between neighbouring processes is composed of two rows of peribasal meshes and with a third row of smaller mashes interposed (the third row sometimes missing) (Figures 14A, B, 15A–D). Mesh diameter is usually larger than the mesh walls and nodes (Figures 14A, B, 15A–D). The meshes are 0.4–1.4 μm in diameter, with roundish irregular shape. The pillars connecting the reticulum with the chorion surface are visible only under SEM (Figure 15C). The bases of the processes are surrounded by cuticular thickenings that merge into the bars and nodes of the reticulum (Figure 15C, D). These basal thickenings appear under PCM as short dark projections around the process bases (Figure 14A, B). Processes are of the hufelandi type with very elongated concave trunk and extremely reduced (narrow), round and convex terminal discs with irregularly jagged edges (Figures 14C–F, 15). Under SEM the surface of the convex terminal discs is covered by small irregular granules and tubercles (Figures 15C–F).

Figure 14. 

Macrobiotus rybaki sp. nov. – egg chorion morphology under PCM: A, B. Egg surface; C–F. Midsection of the processes. Filled flat arrowheads indicate cuticular thickenings around the processes base that merge into the bars and nodes of the reticulum. Scale bars in μm.

Figure 15. 

Macrobiotus rybaki sp. nov. – egg chorion morphology under SEM: A, B. Entire egg; C–E. Details of the egg processes and egg surface between them; F. Details of the reduced terminal disc. Filled flat arrowheads indicate cuticular thickenings around the processes base that merge into the bars and nodes of the reticulum. Scale bars in μm.

Reproduction / Sexual dimorphism. The species is dioecious. Testis in males, which were clearly visible under PCM up to 24 hours after mounting in Hoyer’s medium, have been found to be filled with spermatozoa, (Figure 16). In females spermathecae filled with spermatozoa were not observed. The species exhibits secondary sexual dimorphism in the form of small lateral gibbosities on the hind legs of males (Figure 16).

Figure 16. 

Macrobiotus rybaki sp. nov. – reproduction: male under PCM. Empty indented arrowhead indicates male’s testis and arrows indicate lateral gibbosities on legs IV. Scale bar in μm.

DNA sequences

18S rRNA: GenBank: MW588028MW588029; 1018 bp long.

28S rRNA: GenBank: MW588034MW588035; 783 bp long.

ITS-2: GenBank: MW588022MW588023; 391 bp long.

COI: GenBank: MW593931MW593932; 658 bp long.

Phenotypic differential diagnosis. By having the OCA of the patagonicus type (only the 2nd and 3rd bands of teeth visible under light microscopy), egg chorion of the hufelandi type (covered with a reticulum), and egg processes with reduced (narrow) terminal disc, Macrobiotus rybaki sp. nov. is most similar to four species: Macrobiotus dariae Pilato & Bertolani, 2004, Macrobiotus noemiae Roszkowska & Kaczmarek, 2019, Macrobiotus santoroi Pilato & D’Urso, 1976 and Macrobiotus serratus Bertolani, Guidi & Rebecchi, 1996. The new species differs specifically from:

Figure 17. 

Macrobiotus anemone Meyer, Domingue & Hinton, 2014 (type series) – egg chorion morphology under PCM: A, B. Egg surface (slides 9551 and 9552 respectively). Filled flat arrowheads indicate a cavity between the process trunk and tentacular arms that appears in PCM as a clearly refracted dot. Scale bars in μm.

  1. M. dariae by having a more anteriorly placed stylet support insertion point (pt 73–75.5 in the new species vs. 77.2–77.9 in M. dariae), a narrower buccal tube external diameter (pt 12.3–15.6 in the new species vs. 15.6–25.7 in M. dariae), a smaller number of processes on the egg circumference (25–34 in the new species vs. 34–38 in M. dariae), a different egg process morphology (processes with very elongated concave trunks and extremely reduced – narrow – convex terminal discs in the new species vs. conical processes with flexible distal portion without terminal discs in M. dariae; Figure 18A–C).
  2. M. noemiae by having a more anterior stylet support insertion point (pt 73.0–75.5 in the new species vs. 78.3–81.8 in M. noemiae), by a smaller number of processes on the egg circumference (25–34 in the new species vs. 35–36 in M. noemiae), by well-defined reticulation on the chorion surface with the peribasal mesh larger than the interbasal mesh and mesh diameter larger than the walls and nodes of the reticulum (very delicate and faint reticulation with mesh of uniform size distributed randomly on the egg surface between the processes in M. noemiae), a different egg processes morphology (processes with very elongated concave trunks and extremely reduced – narrow – convex terminal discs without flexible filaments in the new species vs. conical processes without terminal discs but with hair-like, and flexible filaments in M. noemiae).
  3. M. santoroi by having taller egg processes (6.7–13.4 µm in the new species vs. 4 µm or less in M. santoroi), by a smaller number of processes on the egg circumference (25–34 in the new species vs. 37–40 in M. santoroi), by processes with very elongated concave trunks (processes peg-shaped in M. santoroi), by well-defined reticulation on the chorion surface with the peribasal mesh larger than the interbasal mesh and mesh diameter larger than walls and nodes of the reticulum (very fine mesh with evident and wide walls and nodes, giving the false impression of a granulated surface in M. santoroi).
  4. M. serratus by having a more anterior stylet support insertion (pt 73.0–75.5 in the new species vs. 75.6–77.7 in M. serratus), by a taller egg process height (6.7–13.4 µm in the new species vs. 5.5–6.0 µm in M. serratus) and by well-defined reticulation on the chorion surface with the peribasal mesh larger than the interbasal mesh and mesh diameter larger than walls and nodes of the reticulum (very delicate and faint reticulation with mesh of similar sizes distributed uniformly on the egg surface between processes in M. serratus; Figure 18D, E).

Phylogenetic analysis

The phylogenetic reconstruction (Figure 19) recovered the genus Macrobiotus as well as the three clades found by Stec et al. (2021) and by Kiosya et al. (2021) to be monophyletic. All three clades have high support values (pp=1). The new species Macrobiotus annewintersae sp. nov. belongs to subclade B, within the Macrobiotus persimilis complex, even though the monophyly of this complex was not strongly supported (pp=0.73). Macrobiotus engbergi Stec, Tumanov & Kristensen, 2020 was recovered as the closest relative of M. annewintersae sp. nov. (Figure 19). The second species analysed in this study, Macrobiotus rybaki sp. nov., belongs to subclade A with its closest relatives being Macrobiotus wandae Kayastha, Berdi, Miaduchowska, Gawlak, Łukasiewicz, Gołdyn & Kaczmarek, 2020 and Macrobiotus vladimiri Bertolani, Biserov, Rebecchi & Cesari, 2011 (Figure 19). The newly found Swedish population identified in this study as Macrobiotus aff. polonicus, as could have been predicted from its morphological similarity with that species, clusters together with two populations of Macrobiotus polonicus Pilato, Kaczmarek, Michalczyk & Lisi, 2003 from Austria and Slovakia (Figure 19).

Figure 18. 

Macrobiotus dariae Pilato & Bertolani, 2004 and Macrobiotus serratus Bertolani, Guidi & Rebecchi, 1996 (type series) – egg chorion morphology under PCM: A–C. Egg surface (A) and midsections of the processes (B, C) of M. dariae (slides PC45s1 and PC45s3 respectively); D, E. Egg surface of M. serratus (slides C1907s17 and C1907s30 respectively). Scale bars in μm.

Figure 19. 

Phylogenetic reconstruction of the genus Macrobiotus, topology of BI analysis. Nodes with pp<70 were collapsed. Clades A–C from Stec et al. (2021) are indicated. * indicates nodes with support pp=1. Numbers after species names (when present) indicate different haplotypes or individuals from the same population. Outgroups not shown. Country abbreviations after species names (when present) indicate different populations (AT: Austria; SE: Sweden; SK: Slovakia).

Discussion

We identified two new tardigrade species in the genus Macrobiotus using an integrative taxonomy approach combining the analyses of detailed morphological and genetic data. Thanks to the phylogenetic analysis performed in this study we confirmed Macrobiotus annewintersae sp. nov. to belong to the Macrobiotus persimilis complex (as defined by Stec et al. 2021). Nevertheless, the morphological definition provided by Stec et al. (2021) does not encompass the extraordinary egg phenotype exhibited by Macrobiotus annewintersae sp. nov., indicating the need for further amendment of the characters describing this monophyletic group of species. The definition of that complex, regarding the egg processes, states “[…] single-walled egg processes […] in the shape of truncated cones terminated with a well-developed disc and with solid chorion surface […]”, It is therefore clear that as M. annewintersae sp. nov. possesses 2–8 tentacular arms on the distal part of its egg processes, as opposed to ‘well-developed discs’, it falls outside the current definition of the group. Very similar egg processes are also present in M. anemone, which was previously included in the M. persimilis complex by Stec et al. (2021) without any elaboration on that issue (please see Table 5 in Stec et al. (2021) for the list of species included there in the complex). Therefore, to avoid inconsistency in accommodating these two species within the M. persimilis complex, we propose an upgraded definition that reads: species with white body, hufelandi type claws and with single-walled egg processes (without the labyrinthine layer = not reticulated) in the shape of truncated cones terminated with a well-developed disc or tentacular arms and with a solid chorion surface (the surface can be wrinkled and sometimes with faintly visible micropores but never properly porous or reticulated). Furthermore, we propose to tentatively include Macrobiotus andinus Maucci, 1988 within the M. persimilis complex. The species meet now all the criteria except the porous cuticle, (hence it was not considered as a member of the hufelandi group sensu Kaczmarek and Michalczyk (2017), but it is likely that these pores could be visible only under SEM similarly as in same species of the Macrobiotus pseudohufelandi complex (Stec et al. 2021).

In their faunistic study devoted to Greek tardigrades Maucci and Durante Pasa (1982) reported Macrobiotus anderssoni Richters, 1907, specifically from the island of Crete. According to the description provided by Maucci and Durante Pasa (1982), their Macrobiotus anderssoni population from Crete is very similar to M. rybaki sp. nov. described in our study, with the only considerable difference being dentation on lunulae IV, that is present only in M. rybaki sp. nov.. Therefore, it is highly likely that these two populations represent closely related taxa, however, more populations from this region should be examined using an integrative approach to reliably test such a hypothesis.

Based on newly found M. anderssoni material, Maucci and Durante Pasa (1982) proposed a redescription of that species. However, the proposed redescription cannot be considered as valid as they failed to designate a neotype. Even if they had done so, several regulations of the International Code of Zoological Nomenclature (ICZN 1999) and the conditions listed in Article 75.3 of the code would not have been fulfilled. Specifically, (i) the authors did not provide reasons for believing the name-bearing type specimen(s) (i.e., holotype, or lectotype, or all syntypes, or prior neotype) to be lost or destroyed, and the steps that had been taken to trace it or them; (ii) the population that they studied did not come, as nearly as practicable, from the original type locality (terra typica of M. anderssoni is Tierra del Fuego in Argentina). Moreover, Roszkowska et al. (2016) have already questioned the identification of the population from Crete, stating that it belongs to an unrecognised species of the Macrobiotus hufelandi group. In light of the discussion in Roszkowska et al. (2016) on the taxonomic uncertainty concerning M. anderssoni, further supported by the newly found egg that fits perfectly with Richters’ description and which was found near terra typica, we agree with the authors’ claims that it is highly likely that M. anderssoni represents the genus Mesobiotus Vecchi, Cesari, Bertolani, Jönsson, Rebecchi & Guidetti, 2016. Nevertheless, a more robust conclusion can only be made following an integrative redescription of the species, based on a population from Tierra del Fuego or nearby locality, becoming available.

Our study describes yet another two new species of the genus Macrobiotus utilising the integrative taxonomy approach. The detailed morphological examination linked with genetic data in the form of DNA sequences has allowed us also to elucidate the phylogenetic position of the studied taxa and amend the definition of the Macrobiotus persimilis complex. This further underlines the pre-eminence of the integrative approach, compared with classical taxonomy, in more reliably testing species hypotheses.

Acknowledgements

We are especially grateful to our colleagues Anne Winters, Małgorzata Mitan and Małgorzata Osielczak for collecting samples which enabled us to conduct this study and to Brian Blagden as well as Łukasz Michalczyk and Sara Calhim for improving the English and their critical reading of our manuscript. Moreover, we thank Roberto Guidetti, Roberto Bertolani, Witold Morek, Piotr Gąsiorek and the Natural History Museum of Verona for making the Bertolani and Maucci collections available and providing photographs of M. dariae, M. serratus and M. andinus type material and Harry Meyer for providing photographs of M. anemone type material. We also thank Edoardo Massa, Yevgen Kiosya and an anonymous reviewer for their constructive criticism. During this study, DS was a beneficiary of a National Science Centre scholarship to support doctoral research (no. 2019/32/T/NZ8/00348) and MV was supported by the Academy of Finland (Fellowship #314219 to Sara Calhim). The study was supported by the Sonata Bis programme of the Polish National Science Centre (grant no. 2016/22/E/NZ8/00417 to Łukasz Michalczyk) and by the Academy of Finland Fellowship to Sara Calhim (#314219).

References

  • Astrin JJ, Stüben PE (2008) Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera: Curculionidae). Invertebrate Systematics 22(5): 503–522. https://doi.org/10.1071/IS07057
  • Bah T (2011) Inkscape: guide to a vector drawing program (Vol. 559). Upper Saddle River, NJ, USA: Prentice Hall.
  • Bartels PJ, Nelson DR (2007) An evaluation of species richness estimators for tardigrades of the Great Smoky Mountains National Park, Tennessee and North Carolina, USA. Journal of Limnology 66: e104. https://doi.org/10.4081/jlimnol.2007.s1.104
  • Bartels PJ, Nelson DR, Exline RP (2011) Allometry and the removal of body size effects in the morphometric analysis of tardigrades. Journal of Zoological Systematics and Evolutionary Research 49: 17–25. https://doi.org/10.1111/j.1439-0469.2010.00593.x
  • Bertolani R (1982) A new genus and five new species of Italian fresh-water tardigrades. Bollettino del Museo Civico di storia Naturale, Verona 114: 249–254.
  • Bertolani R, Guidi A, Rebecchi L (1996) Tardigradi della Sardegna e di alcune piccole isole circumsarde. Biogeographia – The Journal of Integrative Biogeography 18(1): 229–247. https://doi.org/10.21426/B618110456
  • Bertolani R, Biserov V, Rebecchi L, Cesari M (2011) Taxonomy and biogeography of tardigrades using an integrated approach: new results on species of the Macrobiotus hufelandi group. Invertebrate Zoology 8(1): 23–36. https://doi.org/10.15298/invertzool.08.1.05
  • Bertolani R, Guidetti R, Marchioro T, Altiero T, Rebecchi L, Cesari M (2014) Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Molecular Phylogenetics and Evolution 76: 110–126. https://doi.org/10.1016/j.ympev.2014.03.006
  • Bochnak M, Vončina K, Kristensen RM, Gąsiorek P (2020) Continued exploration of Tanzanian rainforests reveals a new echiniscid species (Heterotardigrada). Zoological Studies 59(18): 1–13. https://doi.org/10.6620/ZS.2020.59-18
  • Casquet J, Thebaud C, Gillespie RG (2012) Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources 12: 136–141. https://doi.org/10.1111/j.1755-0998.2011.03073.x
  • Coughlan K, Stec D (2019) Two new species of the Macrobiotus hufelandi complex (Tardigrada: Eutardigrada: Macrobiotidae) from Australia and India, with notes on their phylogenetic position. European Journal of Taxonomy 573: 1–38. https://doi.org/10.5852/ejt.2019.573
  • Coughlan K, Michalczyk Ł, Stec D (2019) Macrobiotus caelestis sp. nov., a new tardigrade species (Macrobiotidae: hufelandi group) from the Tien Shan mountains (Kyrgyzstan). Annales Zoologici 69(3): 499–513. https://doi.org/10.3161/00034541ANZ2019.69.3.002
  • Dastych H (1980) Niesporczaki (Tardigrada) Tatrzańskiego Parku Narodowego. Monografie Fauny Polski 9: 1–232.
  • Doyère ML (1840) Memorie sur les Tardigrades. Annales des Sciences Naturelles. Zoologie 14: 269–362.
  • Durante Pasa MV, Maucci W (1979) Tardigradi muscicoli della Grecia. Zeszyty Naukowe Uniwersytetu Jagiellohskiego 529: 19–45.
  • Edgar R (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32(5): 1792–1797. https://doi.org/10.1093/nar/gkh340
  • Gąsiorek P, Stec D, Zawierucha Z, Kristensen RM, Michalczyk Ł (2018) Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472(2): 261–297. https://doi.org/10.11646/zootaxa.4472.2.3
  • Guidetti R, Bertolani R (2005) Tardigrade taxonomy: an updated check list of the taxa and a list of characters for their identification. Zootaxa 845: 1–46. https://doi.org/10.11646/zootaxa.845.1.1
  • Guidetti R, Schill RO, Giovannini I, Massa E, Goldoni SE, Ebel C, Förschler MI, Rebecchi L, Cesari M (2021) When DNA sequence data and morphological results fit together: Phylogenetic position of Crenubiotus within Macrobiotoidea (Eutardigrada) with description of Crenubiotus ruhesteini sp. nov. Journal of Zoological Systematics and Evolutionary Research 59(3): 576–587. https://doi.org/10.1111/jzs.12449
  • Hinton JG, Meyer HA (2009) Tardigrada of Mississippi. Proceedings of the Louisiana Academy of Sciences 67: 23–27.
  • Kaczmarek Ł, Cytan J, Zawierucha K, Diduszko D, Michalczyk Ł (2014) Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa 3790(2): 357–379. https://doi.org/10.11646/zootaxa.3790.2.5
  • Kaczmarek Ł, Zawierucha K, Buda J, Stec D, Gawlak M, Michalczyk Ł, Roszkowska M (2018) An integrative redescription of the nominal taxon for the Mesobiotus harmsworthi group (Tardigrada: Macrobiotidae) leads to descriptions of two new Mesobiotus species from Arctic. PLoS ONE 13(10): e0204756. https://doi.org/10.1371/journal.pone.0204756
  • Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Resources 30: 3059–3066. https://doi.org/10.1093/nar/gkf436
  • Kayastha P, Berdi D, Mioduchowska M, Gawlak M, Łukasiewicz A, Gołdyn B, Kaczmarek Ł (2020a) Some tardigrades from Nepal (Asia) with integrative description of Macrobiotus wandae sp. nov. (Macrobiotidae: hufelandi group). Annales Zoologici 70(1): 121–142. https://doi.org/10.3161/00034541ANZ2020.70.1.007
  • Kayastha P, Bartylak T, Gawlak M, Kaczmarek Ł (2020b) Integrative Description of Pseudechiniscus lalitae sp. nov. (Tardigrada: Heterotardigrada: Echiniscidae) from the Azores Archipelago (Portugal). Annales Zoologici 70(4): 487–505. https://doi.org/10.3161/00034541ANZ2020.70.4.002
  • Kiosya Y, Pogwizd J, Matsko Y, Vecchi M, Stec D (2021) Phylogenetic position of two Macrobiotus species with a revisional note on Macrobiotus sottilei Pilato, Kiosya, Lisi and Sabella, 2012 (Tardigrada: Eutardigrada: Macrobiotidae). Zootaxa 49333(1): 113–135. https://doi.org/10.11646/zootaxa.4933.1.5
  • Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33: 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Kuzdrowska K, Mioduchowska M, Gawlak M, Barylak T, Kepel A, Kepel M, Kaczmarek Ł (2021) Integrative description of Macrobiotus porifini sp. nov. (Macrobiotidae) from Madagascar and its phylogenetic position within the hufelandi group. European Zoological Journal 88(1): 375–389. https://doi.org/10.1080/24750263.2021.1883752
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2016) PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. https://doi.org/10.1093/molbev/msw260
  • Maucci W (1988) Tardigrada from Patagonia (Southern South America) with description of three new species. Revista Chilena de Entomología 16: 5–13.
  • Maucci W, Durante Pasa MV (1982) Tardigradi della Grecia (secondo contributo), con particolare riferimento alla fauna del’isola di Creta. Bollettino del Museo Civico di Storia Naturale di Verona 9: 479–488.
  • Marcus E (1936) Tardigrada. Das Tierreich 66, 340 pp.
  • Meyer HA, Domingue MN, Hinton JG (2014) Tardigrada of the West Gulf Coastal Plain, with descriptions of two new species from Louisiana. Southeastern Naturalist 13(5): 117–130. https://doi.org/10.11646/zootaxa.3747.1.1
  • Michalczyk Ł, Kaczmarek Ł (2003) A description of the new tardigrade Macrobiotus reinhardti (Eutardigrada: Macrobiotidae, harmsworthi group) with some remarks on the oral cavity armature within the genus Macrobiotus Schultze. Zootaxa 331(1): 1–24. https://doi.org/10.11646/zootaxa.331.1.1
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 gateway computing environments workshop (GCE): 1–8. https://doi.org/10.1109/GCE.2010.5676129
  • Mironov SV, Dabert J, Dabert M (2012) A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253: 54–61. https://doi.org/10.11646/zootaxa.3253.1.2
  • Morek W, Stec D, Gąsiorek P, Schill RO, Kaczmarek Ł, Michalczyk Ł (2016) An experimental test of eutardigrade preparation methods for light microscopy. Zoological Journal of the Linnean Society 178: 785–793. https://doi.org/10.1111/zoj.12457
  • Morek W, Ciosek JA, Michalczyk Ł (2020) Description of Milnesium pentapapillatum sp. nov., with an amendment of the diagnosis of the order Apochela and abolition of the class Apotardigrada (Tardigrada). Zoologischer Anzeiger 288: 107–117. https://doi.org/10.1016/j.jcz.2020.07.002
  • Nelson DR, Fletcher RA, Guidetti R, Roszkowska M, Grobys D, Kaczmarek Ł (2020a) Two new species of Tardigrada from moss cushions (Grimmia sp.) in a xerothermic habitat in northeast Tennessee (USA, North America), with the first identification of males in the genus Viridiscus. PeerJ 8: e10251. https://doi.org/10.7717/peerj.10251
  • Nelson DR, Bartels PJ, Fegley SR (2020b) Environmental correlates of tardigrade community structure in mosses and lichens in the Great Smoky Mountains National Park (Tennessee and North Carolina, USA). Zoological Journal of the Linnean Society 188(3): 913–924. https://doi.org/10.1093/zoolinnean/zlz043
  • Nowak B, Stec D (2018) An integrative description of Macrobiotus hannae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Poland. Turkish Journal of Zoology 42(3): 269–286. https://doi.org/10.3906/zoo-1712-31
  • Pilato G (1981) Analisi di nuovi caratteri nello studio degli Eutardigradi. Animalia 8: 51–57.
  • Pilato G, D’Urso V (1976) Contributo alla conoscenza dei Tardigradi d’Australia. Animalia 3(1): 135–145.
  • Pilato G, Kaczmarek Ł, Michalczyk Ł, Lisi O (2003) Macrobiotus polonicus, a new species of Tardigrada from Poland (Eutardigrada: Macrobiotidae, ‘hufelandi group’). Zootaxa 258: 1–8. https://doi.org/10.11646/zootaxa.258.1.1
  • Pogwizd J, Stec D (2020) New records of Dactylobiotus parthenogeneticus Bertolani, 1982 provide insight into its genetic variability and geographic distribution. Folia Biologica 68(2): 57–72. https://doi.org/10.3409/fb_68-2.08
  • Rambaut A (2007) FigTree, a graphical viewer of phylogenetic trees.
  • Rambaut A, Drummond A, Xie D, Baele G, Suchard M (2018) Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Systematic Biology 67(5): 901–904. https://doi.org/10.1093/sysbio/syy032
  • R Core Team (2020) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna. https://www.R-project.org/
  • Richters F (1903) Nordische tardigraden. Zoologischer Anzeiger 27(5): 168–172.
  • Richters F (1907) Die Fauna der Moosrasen des Gaussbergush. IX. Tardigraden.
  • Richters F (1926) Tardigrada. In: Kükenthal W, Krumbach T (Eds) Handbuch der Zoologie 3: 58–61.
  • Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Höhna S, Larget B, Liu L, Suchard M, Huelsenbeck J (2012) MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Roszkowska M, Kaczmarek Ł (2019) Macrobiotus noemiae sp. nov., a new tardigrade species (Macrobiotidae: hufelandi group) from Spain. Turkish Journal of Zoology 43(4): 331–348. https://doi.org/10.3906/zoo-1902-5
  • Roszkowska M, Stec D, Ciobanu DA, Kaczmarek Ł (2016) Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species. Zootaxa 4105(3): 243–260. https://doi.org/10.11646/zootaxa.4105.3.2
  • Roszkowska M, Ostrowska M, Stec D, Janko K, Kaczmarek Ł (2017) Macrobiotus polypiformis sp. nov., a new tardigrade (Macrobiotidae; hufelandi group) from the Ecuadorian Pacific coast, with remarks on the claw abnormalities in eutardigrades. European Journal of Taxonomy 327: 1–19. https://doi.org/10.5852/ejt.2017.327
  • Roszkowska M, Stec D, Gawlak M, Kaczmarek Ł (2018) An integrative description of a new tardigrade species Mesobiotus romani sp. nov. (Macrobiotidae: harmsworthi group) from the Ecuadorian Pacific coast. Zootaxa 4450(5): 550–564. https://doi.org/10.11646/zootaxa.4450.5.2
  • Schultze CAS (1834) Macrobiotus Hufelandii animal e crustaceorum classe novum, reviviscendi post diuturnam asphixiam et aridiatem potens. C. Curths, Berlin, 6 pp.
  • Schuster RO, Nelson DR, Grigarick AA, Christenberry D (1980) Systematic criteria of the Eutardigrada. Transactions of the American Microscopical Society 99: 284–303. https://doi.org/10.2307/3226004
  • Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł (2015) An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052: 501–526. https://doi.org/10.11646/zootaxa.4052.5.1
  • Stec D, Gąsiorek P, Morek W, Kosztyła P, Zawierucha K, Kaczmarek Ł, Prokop ZM, Michalczyk Ł (2016) Estimating optimal sample size for tardigrade morphometry. Zoological Journal of the Linnean Society 178: 776–784. https://doi.org/10.1111/zoj.12404
  • Stec D, Zawierucha K, Michalczyk Ł (2017a) An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300(3): 403–420. https://doi.org/10.11646/zootaxa.4300.3.4
  • Stec D, Morek W, Gąsiorek P, Blagden B, Michalczyk Ł (2017b) Description of Macrobiotus scoticus sp. nov. (Tardigrada: Macrobiotidae: hufelandi group) from Scotland by means of integrative taxonomy. Annales Zoologici 67: 181–197. https://doi.org/10.3161/00034541ANZ2017.67.2.001
  • Stec D, Morek W, Gąsiorek P, Michalczyk Ł (2018a) Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Systematics and Biodiversity 16(4): 357–376. https://doi.org/10.1080/14772000.2018.1424267
  • Stec D, Krzywański Ł, Michalczyk Ł (2018b) Integrative description of Macrobiotus canaricus sp. nov. with notes on M. recens (Eutardigrada: Macrobiotidae). European Journal of Taxonomy 452: 1–36. https://doi.org/10.5852/ejt.2018.452
  • Stec D, Kristensen RM, Michalczyk Ł (2018c) Integrative taxonomy identifies Macrobiotus papei, a new tardigrade species of the Macrobiotus hufelandi complex (Eutardigrada: Macrobiotidae) from the Udzungwa Mountains National Park (Tanzania). Zootaxa 4446(2): 273–291. https://doi.org/10.11646/zootaxa.4446.2.7
  • Stec D, Arakawa K, Michalczyk Ł (2018d) An integrative description of Macrobiotus shonaicus sp. nov. (Tardigrada: Macrobiotidae) from Japan with notes on its phylogenetic position within the hufelandi group. PLoS ONE 13(2): e0192210. https://doi.org/10.1371/journal.pone.0192210
  • Stec D, Roszkowska M, Kaczmarek L, Michalczyk Ł (2018e) An integrative description of a population of Mesobiotus radiatus (Pilato, Binda and Catanzaro, 1991) from Kenya. Turkish Journal of Zoology 42(5): 523–540. https://doi.org/10.3906/zoo-1802-43
  • Stec D, Roszkowska M, Kaczmarek Ł, Michalczyk Ł (2018f) Paramacrobiotus lachowskae, a new species of Tardigrada from Colombia (Eutardigrada: Parachela: Macrobiotidae). New Zealand Journal of Zoology 45(1): 43–60. https://doi.org/10.1080/03014223.2017.1354896
  • Stec D, Kristensen RM, Michalczyk Ł (2020a) An integrative description of Minibiotus ioculator sp. nov. from the Republic of South Africa with notes on Minibiotus pentannulatus Londoño et al., 2017 (Tardigrada: Macrobiotidae). Zoologischer Anzeiger 286: 117–134. https://doi.org/10.1016/j.jcz.2020.03.007
  • Stec D, Tumanov DV, Kristensen RM (2020b) Integrative taxonomy identifies two new tardigrade species (Eutardigrada: Macrobiotidae) from Greenland. European Journal of Taxonomy 614: 1–40. https://doi.org/10.5852/ejt.2020.614
  • Stec D, Dudziak M, Michalczyk Ł (2020c) Integrative descriptions of two new Macrobiotidae species (Tardigrada: Eutardigrada: Macrobiotoidea) from French Guiana and Malaysian Borneo. Zoological Studies 59: 1–23. https://doi.org/10.6620/ZS.2020.59-23
  • Stec D, Krzywański Ł, Zawierucha K, Michalczyk Ł (2020d) Untangling systematics of the Paramacrobiotus areolatus species complex by an integrative redescription of the nominal species for the group, with multilocus phylogeny and species delineation in the genus Paramacrobiotus. Zoological Journal of the Linnean Society 188(3): 694–716. https://doi.org/10.1093/zoolinnean/zlz163
  • Stec D, Krzywański Ł, Arakawa K, Michalczyk Ł (2020e) A new redescription of Richtersius coronifer, supported by transcriptome, provides resources for describing concealed species diversity within the monotypic genus Richtersius (Eutardigrada). Zoological letters 6(1): 1–2. https://doi.org/10.1186/s40851-020-0154-y
  • Stec D, Vecchi M, Calhim S, Michalczyk Ł (2021) New multilocus phylogeny reorganises the family Macrobiotidae (Eutardigrada) and unveils complex morphological evolution of the Macrobiotus hufelandi group. Molecular Phylogenetics and Evolution 106987. https://doi.org/10.1016/j.ympev.2020.106987
  • Surmacz B, Morek W, Michalczyk Ł (2020) What to do when ontogenetic tracking is unavailable: a morphometric method to classify instars in Milnesium (Tardigrada). Zoological Journal of the Linnean Society 188(3): 797–808. https://doi.org/10.1093/zoolinnean/zlz099
  • Tumanov DV (2020a) Integrative redescription of Hypsibius pallidoides Pilato et al., 2011 (Eutardigrada: Hypsibioidea) with the erection of a new genus and discussion on the phylogeny of Hypsibiidae. European Journal of Taxonomy 681: 1–37. https://doi.org/10.5852/ejt.2020.681
  • Tumanov DV (2020b) Integrative description of Mesobiotus anastasiae sp. nov. (Eutardigrada, Macrobiotoidea) and first record of Lobohalacarus (Chelicerata, Trombidiformes) from the Republic of South Africa. European Journal of Taxonomy 726: 102–131. https://doi.org/10.11646/zootaxa.4450.5.2
  • Vecchi M, Cesari M, Bertolani R, Jönsson KI, Rebecchi L, Guidetti R (2016) Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebrate Systematics 30(4): 303–322. https://doi.org/10.1071/IS15033_CO