Research Article |
|
Corresponding author: Patrick D. Mathews ( patrickmathews83@gmail.com ) Academic editor: Pavel Stoev
© 2021 Fabricio B. Sousa, Tiago Milanin, André C. Morandini, Luis L. Espinoza, Anai Flores-Gonzales, Ana L.S. Gomes, Daniele A. Matoso, Patrick D. Mathews.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Sousa FB, Milanin T, Morandini AC, Espinoza LL, Flores-Gonzales A, Gomes ALS, Matoso DA, Mathews PD (2021) Molecular diagnostic based on 18S rDNA and supplemental taxonomic data of the cnidarian coelozoic Ceratomyxa (Cnidaria, Myxosporea) and comments on the intraspecific morphological variation. Zoosystematics and Evolution 97(2): 307-314. https://doi.org/10.3897/zse.97.64769
|
Ceratomyxa amazonensis is a cnidarian myxosporean originally described with strongly arcuate crescent-shaped myxospores, absence of vegetative stages and infecting Symphysodon discus, an important Amazonian ornamental fish in the aquarium industry. As part of a long-term investigation concerning myxosporeans that infect discus fish Symphysodon spp. from different rivers of the Amazon Basin, thirty specimens of S. discus collected from Unini River were examined. Plasmodial vegetative stages therefrom were found freely floating in the bile of gall bladders from eighteen fish. Mature myxospores were slightly crescent-shaped, measuring 4.72 ± 0.1 (4.52–4.81) μm in length, 24.2 ± 0.4 (23.9–25.3) μm in thickness with polar capsules 2.31 ± 0.1 (2.29–2.33) μm in length and 2.15 ± 0.1 (2.13–2.17) μm in width. Strong morphological differences were observed between the newly isolated myxospores obtained and the previously described C. amazonensis; however, molecular assessment, based on 18S rDNA, revealed a high similarity (99.91%), with only a single nucleotide base change. This study provides new data, expanding the original description of the species with a discussion on differences in myxospore-morphology in the context of intraspecific morphological plasticity.
Brazil, ceratomyxid, morphological plasticity, ornamental fish, parasitic cnidarian
The global aquarium market moves millions of ornamental fish worldwide and is the primary mode for international transport of cnidarian myxosporean parasites (
Myxosporeans are endoparasitic microscopic cnidarians with worldwide distributions (
As part of a long-term investigation concerning myxosporeans that infect discus fish Symphysodon spp. from different rivers of the Amazon Basin, specimens of S. discus collected from the Unini River were examined. This study supplements the original description of the cnidarian myxosporean C. amazonensis, providing new data on the stages of and morphological variation in myxospores, thereby extending the original description of the species. Furthermore, differences in myxospore morphology are discussed in the context of intraspecific morphological plasticity.
In August 2019, thirty specimens of S. discus (ranging from 10.3 ± 1.2 cm in total length and 23.4 ± 4.2 g in weight) were collected from the Unini River, near Barcelos Municipality (0°58'30"S, 62°55'26"W), Amazonas State, Brazil. The fishes were sampled under a collection licence issued by the Brazilian Ministry of the Environment (SISBIO Process No. 73241-2). The euthanasia procedure was approved by the Federal University of Amazonas Ethics Committee for Scientific Use of Animals (CEUA-UFAM No. 025/2019). After necropsy, gall bladders were carefully removed and placed in small Petri dishes for further examination under stereo and optical microscopes. Samples of the bile were collected by puncturing the gall bladder using a pointed glass pipette; a drop of bile was then pipetted on to a microscope slide, covered with a cover slip and observed under an Olympus BX53 light microscope at 400× magnification.
Morphological and morphometric analyses were performed on 30 randomly selected mature myxospores using a computer, equipped with Axivision 4.1 image capture software coupled to an Axioplan 2 Zeiss microscope. Following the criteria outlined by
For transmission electron microscopy, infected gall bladders were fixed for two days in 2.5% glutaraldehyde, diluted in 0.1 M sodium cacodylate buffer (pH 7.4), washed in a glucose-saline solution for 2 h and post-fixed in 2% osmium tetroxide (OsO4) for 4 to 5 h. After dehydration in an ascending concentration series of ethanol, the samples were embedded in EMbed 812 resin (Electron Microscopy Sciences, Hatfield, PA, USA) (
Genomic DNA (gDNA) was extracted from infected bile of a fish sample and preserved in absolute ethanol. The sample was pelleted through centrifugation at 8,000 rpm for 12 min and the ethanol removed. The gDNA was extracted from the pellet using a DNeasy Blood & Tissue Kit (animal tissue protocol) (Qiagen Inc., California, USA), in accordance with the manufacturer’s instructions. The gDNA concentration was quantified in a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, USA) at 260 nm. Polymerase chain reaction (PCR) was performed in accordance with
The amplification of the partial 18S rDNA was performed on a Mastercycler nexus (Eppendorf, Hamburg, Germany) and the PCR cycle consisted of an initial denaturation step at 95 °C for 5 min, followed by 35 denaturation cycles at 95 °C for 1 min, annealing at 60 °C for 1 min and extension at 72 °C for 2 min, with a terminal extension at 72 °C for 5 min. A control reaction was processed in order to check for possible contamination. The amplified PCR product was subjected to electrophoresis on 1.0% agarose gel (BioAmerica, California, USA) in a TAE buffer (Tris–Acetate EDTA: Tris 40 mM, acetic acid 20 mM, EDTA 1 mM), stained with Sybr Safe DNA gel stain (Invitrogen by Life Technologies, California, USA) and then analysed with a Stratagene 2020E trans-illuminator. For sizing and approximate quantification of PCR product, 1 Kb Plus DNA Ladder (Invitrogen by Life Technologies, USA) was used. The PCR product was purified on a USB ExoSap-IT (Thermo Fisher Scientific, Massachusetts, USA) in accordance with the manufacturer’s instructions and sequenced using the PCR primer pair, as well as the additional primer pair MC5, CCTGAGAAACGGCTACCACATCCA and MC3, GATTAGCCTGACAGATC ACTCCACGA (
Freely-floating plasmodia were found in the gall bladder bile of 18 (60%) out of the 30 S. discus specimens collected in the Unini River. After rupturing the plasmodia, slightly crescent-shaped mature myxospores were observed with sub-spherical polar capsules. These capsules were located close to the myxospore suture line in a plane perpendicular to it, at the anterior myxospore pole, thus defining classification within the genus Ceratomyxa. No signs of infection were observed in the parasitised organs.
Plasmodia were asymmetric and slightly elongated, with mean length 62.3 (range 58.4–64.2) μm and mean width 7.8 (range 6.6–8.9) μm; they contained both mature myxospores and early sporogonic stages (Fig.
Light photomicrographs of Ceratomyxa amazonensis plasmodia. a, b. Slightly elongated plasmodia showing mature myxospores (white asterisks) and few early sporogonic stages (arrows); c. Spherical plasmodium with two slightly crescent-shaped mature myxospores (ms) and containing early sporogonic stages (arrows); d. Differential interference contrast microscopy snapshot of a slightly crescent-shaped mature myxospore. Scale bars: 10 µm.
Transmission electron microscopy images of Ceratomyxa amazonensis isolated of Symphysodon discus from the Unini River, Amazonas State, Brazil. a. Myxospore showing two sub-spherical polar capsules and sporoplasm (sp) occupying most of the myxospore volume; b. Detail of the apical suture (black arrow) and sporoplasmosomes (arrowheads); c. Detail of lateral suture (black arrow); d. Polar capsule displaying still uncoiled internal polar tubule (black arrow). Scale bars: 2 µm (a); 1 µm (c); 500 nm (b, d).
Host: Symphysodon discus Heckel, 1840 (Perciformes: Cichlidae).
Type locality: Unini River, near Barcelos Municipality (0°58'30"S, 62°55'26"W), Amazonas State, Brazil.
Sites of infection: Within gall bladder (plasmodia floating free in the bile).
Material deposited: The partial 18S rDNA gene sequence was deposited in GenBank (accession number MN064752). Slides with stained myxospores and vials containing formalin-fixed plasmodia were deposited in the cnidarian collection of the Zoology Museum at the University of São Paulo – USP, São Paulo, Brazil (MZUSP 8469).
The BLAST search revealed a high similarity between the newly-obtained 18S rDNA gene sequence and a previously-published sequence of C. amazonensis (query cover 100%, maximum identity 99.91%), a parasite of S. discus from Rio Negro River. The pairwise comparison between the new isolate from the Unini River and a previously deposited 18S rDNA gene sequence of C. amazonensis found an overall genetic divergence of 0.1% with just a single nucleotide base change between the two sequences (Table
Pairwise genetic distance of 18S rDNA sequences from Ceratomyxa species described from strictly Amazonian fish hosts. The upper triangular matrix shows the number of different nucleotide positions; the lower triangular matrix shows the percentage of differing nucleotide positions.
| Species (GenBank ID) | 1 | 2 | 3 | 4 | 5 |
|---|---|---|---|---|---|
| 1. Unini River isolates (this study) (MN064752) | - | 77 | 48 | 32 | 1 |
| 2. Ceratomyxa gracillima (KY934184.1) | 7 | - | 92 | 109 | 109 |
| 3. Ceratomyxa vermiformis (KX278420.1) | 4 | 5.2 | - | 82 | 74 |
| 4. Ceratomyxa brasiliensis (KU978813.1) | 3 | 6.8 | 5.1 | - | 38 |
| 5. Ceratomyxa amazonensis (KX236169.1) | 0.1 | 6.9 | 4.7 | 2.4 | - |
As pointed out by
Morphological plasticity in myxospores are acknowledged to be one of the main factors responsible for the difficulties encountered in myxosporean taxonomy and species identification, resulting in taxonomic dilemmas (
In our study, the morphological comparison between the new myxospore isolate from Unini River, S. discus and previously described C. amazonensis myxospores found in specimens from the Rio Negro River, shows some dissimilar characteristics (Table
Based on the discussion above, we infer that the myxospores, newly isolated from Unini River S. discus, should be regarded as belonging to the previously described species C. amazonensis. Furthermore, the observations made during this study highlight that classifications, based strictly on morphology, can result in ambiguous descriptions and reinforce the importance of molecular methods (DNA sequencing) for identifying and distinguishing between Ceratomyxa species.
Comparative morphometric data for the newly-isolated myxospores and other Ceratomyxa parasites of Amazonian fish. T: thickness; L: length; PCL: length of polar capsule; PCW: width of polar capsule; PA°: Polar angle; –: no data. All measurements expressed as mean ± SD.
| Species | T | L | PCL | PCW | PA° | Source |
|---|---|---|---|---|---|---|
| New isolate | 24.2 ± 0.4 | 4.7 ± 0.1 | 2.31 ± 0.1 | 2.15 ± 0.1 | 154 | This study |
| C. amazonensis | 15.8 ± 0.4 | 7.0 ± 0.3 | 3.2 ± 0.3 | 2.6 ± 0.2 | 103.7 |
|
| C. fonsecai | 28.9 ± 2.7 | 2.6 ± 0.1 | 1.9 ± 0.3 | 1.7 ± 0.2 | 164.8 | Silva et al. (2020) |
| C. mylei | 24.6 ± 08 | 5.1 ± 0.2 | 2.1 ± 0.3 | - | - |
|
| C. brasiliensis | 41.2 ± 2.9 | 6.3 ± 0.6 | 2.6 ± 0.3 | 2.5 ± 0.4 | 147 |
|
| C. gracillima | 28.0 ± 3.4 | 4.4 ± 1.1 | 1.9 ± 0.4 | 1.9 ± 0.4 | 36.6 |
|
| C. microlepis | 35.5 ± 0.9 | 5.2 ± 0.4 | 2.2 ± 0.3 | 2.2 ± 0.3 |
|
|
| C. vermiformis | 8.4 ± 0.4 | 4.5 ± 0.2 | 2.7 ± 0.1 | 2.7 ± 0.1 | 30.2 |
|
The authors thank the fishermen of the Municipality of Barcelos, Amazonas State, for the provision of the fishes, Dr. Berger for reviewing the English idiom and Prof. R. Sinigaglia-Coimbra from the Electron Microscopy Center (CEME) at UNIFESP for supporting the TEM analysis. P.D. Mathews thanks the São Paulo Research Foundation, FAPESP, for a Post-Doc fellowship (grant No. 2018/20482-3). A.C. Morandini was funded by CNPq (304961/2016-7) and FAPESP (2015/21007-9). T. Milanin thanks FAPESP for a Post-Doc fellowship (grant No. 2015/18807-3). This work was supported by the CNPq (465540/2014-7) and FAPEAM (062.1187/2017).