New specimens were collected either during the day by searching the leaf litter, or at night using torches and headlamps, sometimes guided by the male advertisement call. Representative voucher specimens were euthanized, and then fixed in 90% ethanol or 10% buffered formalin, rinsed in water and preserved in 70% ethanol. Live colouration was photographed at the time of capture.

Locality information were recorded using a GPS, datum WGS84. Field numbers FAZC, ACZC and ACZCV, FGZC, and PBZT-RJS refer to F. Andreone, A. Crottini, F. Glaw, and J.E. Randrianirina, respectively. Tissue samples (taken before specimen fixation) were obtained from hindlimb muscle or tongue, and preserved separately in 99% ethanol.

Institutional abbreviations used herein are as follows: ZSM = Zoologische Staatssammlung München, Germany; SMF = Naturmuseum Senckenberg in Frankfurt am Main, Germany; UADBA-A = Amphibian collections of the Université d’Antananarivo Département de Biologie Animale, Madagascar (currently Mention Zoologie et Biodiversité Animale, Faculté des Sciences, Université d’Antananarivo, Antananarivo); MRSN = Museo Regionale di Scienze Naturali, Torino, Italy; MNHN = Muséum National d’Histoire Naturelle de Paris, France; ZFMK = Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Germany; ZMA = Zoölogisch Museum Amsterdam (transferred to Naturalis Biodiversity Center in Leiden), Netherlands; BMNH = Natural History Museum, London, United Kingdom.

Measurements of preserved specimens were taken by MDS with a calliper to the nearest 0.01 mm, rounded to the nearest 0.1 mm (ratios calculated before rounding to avoid compound rounding errors): SVL (snout-vent length), HW (maximum head width), HL (head length, from the rictus to the snout tip), ED (horizontal eye diameter), END (eye-nostril distance), NSD (nostril-snout tip distance), NND (internarial distance), TD (horizontal tympanum diameter), HAL (hand length, from the radioulnar-carpal articulation to the tip of the longest finger), FORL (forelimb length, given by the sum of HAL, lower arm length [LAL] and upper arm length [UAL]), FOL (foot length, from the tarsal-metatarsal articulations to the tip of the longest toe), TARL (tarsus length), FOTL (foot length including tarsus, given by the sum of FOL and TARL), TIBL (tibia length), HIL (hind-limb length, given by the sum of FOL, TARL, TIBL and thigh length [THIL]), IMCL (maximum length of inner metacarpal tubercle). Examined specimens are listed in Table 1. Note that measurements of Plethodontohyla brevipes are from specimens that match the original description of that species in having a uniform brown dorsum and slightly granular dorsal skin. Terminology and description scheme follow Vences et al. (2003), Glaw and Vences (2007a) and Glaw et al. (2007) to allow for better comparison to other Plethodontohyla species.

The holotypes of Phrynocara laeve (SMF 4286), Dyscophus alluaudi (MNHN 1901.235) and Plethodontohyla laevis tsianovohensis (MNHN 1936.47), and one specimen assigned below to Plethodontohyla laevis (MRSN A6340) from Betampona, one specimen assigned below to P. alluaudi (ZSM 89/2004) from Andohahela and one specimen of the Rhombophryne species formerly assigned to P. alluaudi by Glaw and Vences (1992) from Andasibe (ZSM 3/2002) were scanned using X-ray micro-Computed Tomography (micro-CT), in a phoenix|x nanotom m cone-beam micro-CT scanner, following protocols used previously for Madagascan microhylids (e.g. Scherz et al. 2014, 2015a, b, 2016a, b , 2017). The specimens were scanned individually at 140 kV and 80 µA, with a timing of 750 ms, for a total of 20 or 30 minutes (1440 or 2440 images respectively). Reconstruction methods were the same as those used previously (see the aforementioned literature, and especially Scherz et al. 2017). Examination of the internal anatomy of the specimens was conducted in VG STUDIO MAX 2.2 (Volume Graphics GmbH, Heidelberg, Germany). DICOM stacks of the scans and rotational videos are deposited in MorphoSource at the following URL: http://morphosource.org/Detail/ProjectDetail/Show/project_id/396. Portable document file (PDF)-embedded 3D models of select specimens were produced using AMIRA 6.1 (FEI Visualization Sciences Group, Burlington, MA), and are provided as digital Suppl. materials 1–6. Osteological terminology follows Trueb (1968, 1973).

Ten samples of P. laevis from four different localities (Fig. 3) (seven from Betampona Natural Reserve, one from Marovato, one from Anivorano Est and one from near Analalava-Foulpointe); three samples of P. alluaudi (in its new definition but until now referred to as ‘P. bipunctata’; Fig. 4a) from Andohahela (EU341068, Wollenberg et al. 2008), Tsitongambarika (Anosyenne Chain) and Sainte Luce; one sample of P. sp. Ca1 Ranomafana (Ambatolahy, EU341067, Wollenberg et al. 2008; Fig. 4b); three samples of Rhombophryne sp. (formerly assigned to R. alluaudi) from Torotorofotsy (ZCMV 968; EU341105, Wollenberg et al. 2008), Andasibe (ZSM 3/2002; AY594112, Andreone et al. 2005) and Tsararano (MRSN A2620; AY594105, Andreone et al. 2005); one sample of all nominal species of the genus Plethodontohyla (with the exception of P. notosticta for which we included sequences from individuals from two localities, one in the North and one in the South) were used in the molecular analyses (see Table 2 for more details). A homologous sequence of R. testudo, the type species of the genus Rhombophryne, was also included.

Figure 3. 

Individuals of Plethodontohyla laevis in life, illustrating the diversity of colour patterns from different sites of the species known distribution range: (a) MRSN A6188 from Betampona in dorsolateral and (inset) ventral view; (b) MRSN A6181 from Betampona in dorsolateral view; (c) FAZC 13898 from Betampona in dorsolateral view (Photos by Gonçalo M. Rosa); (d) MRSN A6787 from Anivorano Est in dorsolateral and (inset) ventral view (Photo by Jasmin E. Randrianirina); (e) ZSM 189/2016 from Analalava-Foulpointe in dorsolateral view (Photo by Frank Glaw); (f) individual (not collected) from Ambodiriana in dorsolateral view (Photo by Lauric Reynes).

Figure 4. 

Individuals of (a) Plethodontohyla alluaudi in dorsolateral and (inset) ventral view (ZSM 89/2004 , until now referred to as P. bipunctata; from Andohahela); (b) P. sp. Ca01 in dorsolateral view (ZCMV 555; from Ambatolahy); (c) P. brevipes in dorsolateral view (ZSM 649/2003; from Ranomafana); and (d) Rhombophryne sp. (formerly identified as R. alluaudi) in lateral view (ZFMK 52765 from Andasibe) (Photos by Frank Glaw and Miguel Vences).

For the newly obtained samples, total genomic DNA was extracted using Proteinase K (10 mg/ml) digestion followed by a standard salt-extraction protocol (Bruford et al. 1992). We amplified one mitochondrial gene fragment (rrnL large ribosomal RNA or 16S rRNA gene) for all newly obtained tissues samples, and one nuclear gene fragment, the pro-opiomelanocortin (POMC) gene, for a subset of samples (see details in Table 2). Standard polymerase chain reactions were performed in a final volume of 25 μl and using 0.75 μl each of 10 pmol primer, 0.4 μl of total dNTP 10 mM (Promega), 0.1 μl of 5 U/ml GoTaq (Promega), 5 μl 5X Green GoTaq Reaction Buffer (Promega) and 4 μl of MgCl₂ 25mM (Promega). To sequence a fragment of ca. 550 bp of the 3’ terminus of the mitochondrial large ribosomal RNA gene (16S), proven to be suitable for amphibian identification (Vences et al. 2005), we used the primers AC_16S_AR 5’CGCCTGTTTATCAAAAACAT3’ and AC_16S_BR 5’CCGGTYTGAACTCAGATCAYGT3’ modified from Kocher et al. (1989) and Palumbi et al. (1991), using standard protocols. To sequence the POMC fragment, we used the primers POMC DRVF1 5’ATATGTCATGASCCAYTTYCGCTGGAA3’ and POMC DRVR1 5’GGCRTTYTTGAAWAGAGTCATTAGWGG3’ (Vieites et al. 2007) as in Vences et al. (2010). Successfully amplified fragments were purified and sequenced at Macrogen Inc., where labelled fragments were analysed on an ABI 3730XL automated DNA sequencer (Applied Biosystems).

Sequences were compared with GenBank sequences, and chromatographs were visually checked and edited, when necessary, using BIOEDIT 7.0.5.3 (Hall 1999). Gaps were included in the hypervariable regions of the 16S to account for indels in the final alignment. All newly determined sequences have been deposited in GenBank (MG273701–MG273723; Table 2). Uncorrected pairwise distances (p-distance transformed into percentage using the complete deletion option) amongst individuals of the same species and between ingroup analysed species were computed using MEGA 7.0.21 (Kumar et al. 2016).

Bayesian analyses were conducted in MRBAYES 3.2.2 (Ronquist et al. 2012). The GTR+I+G model was determined by AIC in jModelTest2 (Darriba et al. 2012) as the best-fitting model of substitution. We performed two runs of 10 million generations (started on random trees) and four incrementally heated Markov chains (using default heating values), sampling the Markov chains at intervals of 1,000 generations. Stabilization and convergence of likelihood values were checked by visualizing the log likelihoods associated with the posterior distribution of trees in the software TRACER 1.5 (Rambaut and Drummond 2007), and occurred after about 3–3.5 million generations. The first four million generations were conservatively discarded, and six million trees were retained post burn-in and summed to generate the majority rule consensus tree (Fig. 5a). The purpose of the presented phylogenetic analyses is: 1) to show that the four analysed populations of P. laevis form a monophyletic group; 2) to show the closest phylogenetic relationship of this species to P. alluaudi in its new definition and P. sp. Ca01 (which might prove to be conspecific with P. alluaudi); and 3) to show that the specimens formely assigned to ‘Rhombophryne alluaudi’ (from Torotorofotsy, Andasibe, and Tsararano) do not belong to the genus Plethodontohyla, rather than provide a phylogenetic hypothesis of the phylogenetic relationships of Plethodontohyla species and support for the genus monophyly.

Figure 5. 

a) Bayesian inference tree based on 529 bp of the mitochondrial 16S. Asterisks denote Bayesian posterior probabilities values: one asterisk enclosed in parentheses, ≥ 90%; one asterisk, ≥ 98%; two asterisks, ≥ 99–100%. b) Haplotype network reconstruction for the phased alleles of the nuclear POMC gene fragment in P. laevis from Betampona, Marovato and Anivorano Est, P. alluaudi from Tsitongambarika and Andohahela, P. sp. Ca01 from Ambatolahy and Rhombophryne sp. from Torotorofotsy.

Alternative alleles of the analysed POMC gene fragment were inferred using the PHASE algorithm (Stephens et al. 2001) implemented in the software DNASP 5.10.3 (Librado and Rozas 2009). Haplotype network reconstruction of POMC phased sequences (Fig. 5b) was performed using the software TCS 1.21 (Clement et al. 2000). This software employs the method of Templeton et al. (1992) and calculates the number of mutational steps by which pairwise haplotypes differ, computing the probability of parsimony for pairwise differences until the probability exceeds 0.95 (no manual adjustment of threshold was necessary). The minimum number of mutational steps required to connect the two networks obtained using the parsimony method of Templeton et al. (1992) was identified using the 'fix connection limit' option as implemented in TCS.

Vocalizations of P. laevis were recorded in the field with a Marantz PMD 660 digital recorder, accessorized with a semi-directional microphone. Calls were successively analysed with the acoustic software ADOBE AUDITION 3.0. Definition of variables and terminology in call descriptions follow Rosa and Andreone (2010), Rosa et al. (2010, 2011) and Köhler et al. (2017), and calls are compared to described Plethodontohyla vocalizations available in the literature (see Table 3). Recordings were re-sampled at 44,100 Hz and 16 bit resolution in mono and with the ‘Waveform’ extension. Frequency information was obtained through Fast Fourier Transformation (FFT, width 1024 points); the audiospectrogram was obtained with a Hanning window function resolution of 256 bands.

Temporal measurements are provided as range, followed by mean, standard deviation and number of analysed units (n). We measured air temperature (to the nearest 1 °C) with digital devices at close distance to calling frogs (i.e. temperature information refers to air temperature at the time of recording, not body temperature of the calling specimen). The number of recordings did not allow for temperature corrections.

We examined the type material of Dyscophus alluaudi, which is currently assigned to the genus Rhombophryne, and its junior synonyms Phrynocara laeve and Plethodontohyla laevis tsianovohensis (depicted in Fig. 2). As we have intimated previously (Scherz et al. 2016a, b), an increasing body of evidence suggests that the name D. alluaudi is misapplied. Our investigation resulted in strong evidence for taxonomic placement of the respective names:

(1) The holotype of Dyscophus alluaudi, MNHN 1901.235 (Fig. 2c, d), is an adult ovigerous female specimen measuring 47.4 mm in SVL (for all other measurements see Table 1). It has knob-like terminal phalanges, an unossified pubis, tri-radiate prechoanal vomer with the lateral ramus situated at the midpoint, a strongly descending lateral flange of the frontoparietal, a short maxillary facial process, frontoparietals not extending beyond the level of the neopalatine and a well-developed transverse dorsal ridge on the frontoparietal (Fig. 6, see Suppl. material 1). The pectoral girdle has highly reduced clavicles (remaining just as short thin bony elements near the glenoid socket; indicated by arrows in Fig. 6) and a facet near the middle of the anterior edge of the coracoid. The pectoral girdle has been exposed on the specimen, and a thin cartilaginous extension of the procoracoid runs from the anterior glenoid socket to the facet on the leading edge of the coracoid, and then broadens and runs along it to the omosternum (intact only on the left side); the bony remnants of the clavicles are barely discernable through the dissecting microscope, as they are transparent and very thin. A similar condition to that seen in Dyscophus alluaudi was described for the type specimen of Mantipus angeli by Guibé (1974; confirmed by M.D. Scherz, personal observation), which is a synonym of Plethodontohyla tuberata (Peters, 1883). This state was unknown to Scherz et al. (2016a), suggesting the diagnostic value of the ‘absence of clavicles’ paired with absence of nasal-frontoparietal contact for Plethodontohyla recognition must be refined to include also these reduced lateral elements. The configuration is nevertheless clearly different from Rhombophryne, including the reduced clavicles of species like R. mangabensis (M.D. Scherz et al. unpublished data).

Figure 6. 

Skull and pectoral girdle morphology of Plethodontohyla alluaudi and P. laevis. Asterisks indicate the holotypes of each species. Arrows on the pectoral girdle of P. alluaudi MNHN 1901.235 indicate the clavicles. Scale bars indicate 1 mm.

(2) The holotype of Phrynocara laeve, SMF 4286 (Fig. 2a, b), is probably also an adult female (with developing eggs), measuring 38.1 mm in SVL (for all other measurements see Table 1). It lacks clavicles, has knob-like terminal phalanges, an unossified pubis, a tri-radiate prechoanal vomer with the lateral ramus displaced anteriorly, lateral flange of frontoparietal not descending strongly, a short maxillary facial process, frontoparietals extending beyond the level of the neopalatine and a well-developed if discontinuous transverse dorsal ridge on the frontoparietal (Fig. 6, Suppl. material 2). It differs strongly from MNHN 1901.235 in its smaller size (SVL 38.1 vs. 47.4 mm), much narrower head (HW/HL 1.56 vs. 1.85), longer relative forelimb length (FORL/SVL 0.56 vs. 0.47), longer relative hindlimb length (HIL/SVL 1.43 vs. 1.25), the absence of large dark inguinal spots (vs. presence), lateral ramus of the prechoanal vomer displaced anteriorly (vs. central), frontoparietals exceeding the level of the neopalatine (vs. not exceeding the neopalatine) and the weakly descending lateral flange of the frontoparietal (vs. strongly). The pectoral girdle is similar to MNHN 1901.235, but has also been damaged, obscuring the state—it nevertheless lacks the ossified clavicles of that specimen. We therefore conclude that it is not a synonym of D. alluaudi, but instead a valid species in need of resurrection. Its osteology also suggests that it is a member of the genus Plethodontohyla, on the basis of the absence of clavicles and lack of nasal-frontoparietal contact.

(3) The type specimen of Plethodontohyla laevis tsianovohensis, MNHN 1936.47 (Fig. 2e, f), is also an adult, ovigerous female measuring 58.0 mm in SVL (for all other measurements see Table 1). It lacks clavicles, but has the same cartilaginous pectoral arrangement as the holotype of D. alluaudi, but on the left side it has been damaged so that a second pectoral fenestra is formed medial to the anterior facet of the coracoid, where it ought not to be. In addition, it has knob-like terminal phalanges, an ossified pubis, an almost crescentic prechoanal vomer with a weak lateral ramus, a strongly descending lateral flange of the frontoparietal, a long maxillary facial process, frontoparietals not extending beyond the level of the neopalatine and a well-developed transverse dorsal ridge on the frontoparietal (Fig. 6, Suppl. material 3). Its affiliations are not quite clear; it is larger in size than either D. alluaudi or Ph. laeve (SVL 58.0 vs. 47.4 and 38.1 mm, respectively), its arms are longer than those of D. alluaudi but shorter than those of Ph. laeve (FORL/SVL 0.53 vs. 0.47 and 0.56, respectively), it has longer legs than both (HIL/SVL 1.47 vs. 1.25 and 1.43, respectively), its tympanum is broader than both (TD/ED 0.58 vs. 0.53 and 0.40, respectively), and its osteology shares some elements with either species and differs from both in others (e.g. the length of the facial process). Overall, the skeleton and external morphology more closely resembles that of MNHN 1901.235, and we therefore tentatively conclude that P. l. tsianovohensis should be left in the synonymy of D. alluaudi. However, we emphasise that the D. alluaudi and P. l. tsianovohensis type specimens do not agree in all aspects of their morphology, and their type localities are separated by at least 300 km (Fig. 1), so this taxon may eventually be recognized as a valid, species-level name (possibly it may represent P. sp. Ca01, whose osteology has not been studied here, but see below). It must therefore be re-visited in future treatments of the taxonomy of the P. alluaudi complex. In any case, it is the most junior of the available names, and its identity can remain unresolved for the time being.

As a next step, we analysed the osteology and morphology of three more recently collected specimens: (1) ZSM 3/2002, a specimen from Andasibe of the species currently referred to as ‘Rhombophryne alluaudi’ following Blommers-Schlösser (1975) and Glaw and Vences (1992); (2) MRSN A6340, a specimen of a species of Plethodontohyla collected from near the potential type locality of Phrynocara laeve that agrees strongly with the original description of that species; and (3) ZSM 89/2004, a specimen of a species of Plethodontohyla collected in Andohahela, near to the type locality of Dyscophus alluaudi.

(1) ZSM 3/2002 is genetically a member of the genus Rhombophryne (Figs 4d, 5a). Osteologically, it resembles other published and unpublished Rhombophryne skeletons (Scherz et al. 2014, 2015a, b, 2016a, b, 2017, unpublished data) and it differs unambiguously from the holotype of Dyscophus alluaudi: it has fully developed clavicles (vs. rudimentary clavicles present in the holotype of D. alluaudi), two independent dorsal processes on the frontoparietal (rather than a more or less continuous ridge) and a fused presacral VIII and sacrum (Suppl. material 4). Additionally, it lacks inguinal spots and any trace of the pattern originally described for Dyscophus alluaudi. Thus, it is clear that the taxon Dyscophus alluaudi is currently misapplied. Based on its molecular phylogenetic identity (Table 2; Fig. 5a), as well as the presence of curved clavicles and knobbed terminal phalanges, this species is a member of the genus Rhombophryne. It does not match any other described species of Rhombophryne, and will therefore be described in a forthcoming revision of that genus.

(2) MRSN A6340 is a specimen of Plethodontohyla collected at Betampona and genetically similar to other specimens collected at Marovato, Anivorano Est and Analalava-Foulpointe (Table 2; Fig. 5). It is an adult male (collected when calling), measuring 33.0 mm in SVL (for all other measurements see Table 1). It lacks clavicles, has knob-like terminal phalanges, a mostly unossified pubis, a tri-radiate vomer with a lateral ramus displaced anteriorly, lateral flange of frontoparietal not descending strongly, a moderately short maxillary facial process, frontoparietals extending beyond the level of the neopalatine and a well-developed transverse dorsal ridge on the frontoparietal (Fig. 6, Suppl. material 5). In all of these respects, it strongly resembles the osteology of the holotype of Phrynocara laeve. Its external morphology also resembles that species, though it differs somewhat in ratios (but note the variability of measurements shown in Table 1). It differs clearly from Dyscophus alluaudi and Pl. laevis tsianovohensis on the same grounds given above from Ph. laeve, i.e. the absence of large dark inguinal spots (vs. presence in D. alluaudi), lateral ramus of prechoanal vomer displaced anteriorly (vs. central), frontoparietal exceeding the level of the neopalatine (vs. not exceeding the neopalatine) and the weakly descending lateral flange of the frontoparietal (vs. strongly). We therefore conclude that this species is assignable to Plethodontohyla laevis, distinct from Plethodontohyla alluaudi, and we resurrect and re-describe it below based on data from the holotype and our new material.

(3) ZSM 89/2004 is a specimen collected in Andohahela and genetically belonging to the genus Plethodontohyla (Table 2; Figs 4a, 5). This specimen is molecularly similar to other specimens collected at Tsitongambarika and Sainte Luce and moderately similar to the sequence of a specimen collected at Ambatolahy (Fig. 5). ZSM 89/2004 has close genetic affinities to the specimens that we here confer to P. alluaudi, representing a closely related clade (see Fig. 5a). Osteologically, it differs from the holotype of Phrynocara laeve (and other specimens conferred to that taxon) in the following respects: lateral ramus of prechoanal vomer central (vs. displaced anteriorly), and lateral flange of frontoparietal descending strongly (vs. not descending strongly). Its coracoids show distinct facets for the attachment of cartilage, more strongly developed than in P. laevis. By comparison, it differs from Dyscophus alluaudi in the narrower skull, frontoparietals exceeding the level of the neopalatine, absence of clavicle remnants and the proportions of some skull elements (compare the skulls in Fig. 6, Suppl. material 6). However, we hypothesise that these differences between this specimen and the holotype of Dyscophus alluaudi are due to the considerable difference in body size (SVL 29.1 vs. 47.4 mm) and that the proportions of the skull and its ossification are correlates of age and size. The differences to Phrynocara laeve appear more substantial, despite the similarity in size. Both ZSM 89/2004 and UADBA-A 27994 (FGZC 160) possess inguinal spots and agree in external morphology with Dyscophus alluaudi. We therefore attribute these populations from southern Madagascar to Plethodontohyla alluaudi, and we re-describe this species below.

Fig. 4b, c

We note that the specimen representing P. sp. Ca01 (ZCMV 555) from Ambatolahy in eastern Madagascar (21°14’37.92”S, 047°25’34.38”E) is genetically very similar to the samples attributed to P. alluaudi and phylogenetically represents the sister taxon of the specimens here attributed to P. alluaudi. A picture of a specimen of P. sp. Ca01, ZCMV 555 (or 556, a second not yet sequenced individual) was depicted as Plethodontohyla brevipes on page 125 of Glaw and Vences (2007b) and in Fig. 1 of Scherz et al. (2016a). Two additional specimens belonging to this taxon are currently present in the ZSM collection: ZSM 855/2006 and ZSM 856/2006. Elements of the overall appearance of specimens ZCMV 555 (based on the photograph) and ZSM 855/2006 and ZSM 856/2006 disagree with the description of that species, most notably by the presence of a distinct marking over the back of the head (originally described as ‘uniform dark brown above’). In contrast, they bear a remarkable resemblance to P. alluaudi and P. laevis. These specimens may therefore be closely related to the holotype of P. laevis tsianovohensis, which is from an area comparatively near to Ambatolahy. Nevertheless, the taxonomic status of P. sp. Ca01, and also the relationships of Plethodontohyla brevipes based on its holotype (BMNH 1947.2.10.42), clearly need to be revised. This is however beyond the scope of the current study, and must be conducted in the context of a larger revision of the genus. In the diagnoses against P. brevipes presented for the following re-descriptions, we included only measurements from specimens that resemble the original description in having uniformly brown dorsal colouration and slightly granular dorsal skin.

Figs 2a, b, 3, 6, 7, 8, Suppl. materials 2, 5

Resurrection of Plethodontohyla laevis

As we have shown above, several osteological and morphological characters exist to distinguish the holotypes of Dyscophus alluaudi and Phrynocara laeve. Osteological characters suggest that both taxa are members of the genus Plethodontohyla. Specimens recently collected in Betampona Special Reserve closely match the morphology, osteology and appearance of the holotype of Phrynocara laeve. A village named Sakana (in the Vavatenina commune, Toamasina Province) was located by using Google Earth roughly 70 km North of Betampona (17°18’00.00”S, 049°01’59.99”E), and we suspect that this may have been the forest to which Boettger was referring in the original description (Boettger 1913). The newly collected material in Betampona, Marovato, Anivorano Est and Analalava-Foulpointe is genetically and morphologically relatively uniform and it is distinct both from Plethodontohyla alluaudi (in its new definition), and from all other nominal Plethodontohyla species. We therefore resurrect Plethodontohyla laevis (Boettger, 1913) from the synonymy of P. alluaudi and we provide a re-description of it based on the re-examination of its holotype (including its osteology via micro-CT scanning), and examination of additional, newly collected material.

Holotype

SMF 4286, an adult female collected by A. Voeltzkow in 1905 in Sakana, East Madagascar.

Referred material

Adult male (ethanol-fixed, DNA sequenced and included in Rosa et al. 2012: Accession number HM364769) MRSN A6340 (FAZC 13902), collected by G.M. Rosa and J. Noël on 18 November 2007 at Betampona Nature Reserve, campsite Maintimbato (17°53’35.5”S, 049°13’41.3”E, 283 m a.s.l.), Toamasina Province, eastern Madagascar. MRSN A6189 (FAZC 13643), adult female (ethanol-fixed and DNA sequenced), collected by G.M. Rosa and J. Noël on 21 February 2007 at Betampona Reserve campsite Maintimbato (17°53’36.9”S, 049°13’37.2”E, 295 m a.s.l.); MRSN A6181 (FAZC 13494), adult female (ethanol-fixed and DNA sequenced), collected by G.M. Rosa and J. Noël on 4 February 2007 at Betampona Reserve, Piste Principal (17°55’40.5”S, 049°12’07.4”E, 355 m a.s.l.); ZSM 980/2013 (ACZCV 0066), adult male (ethanol-fixed and DNA sequenced), collected by A. Crottini, D. Salvi, E. Scanarini and J.H. Velo on the morning of 9 November 2013 at Betampona Nature Reserve, campsite Sahaïndrana (17°53’55.50”S, 049°12’02.4”E, 327 m a.s.l.); UADBA uncatalogued (ACZCV 0268), adult unsexed (ethanol-fixed and DNA sequenced), collected by A. Crottini, D. Salvi, E. Scanarini, F. Andreone, S. Faravelli, J. Noël and Georges on the evening of 20 November 2013 at Betampona Nature Reserve, campsite Sahabefoza (17°54’54.82”S, 049°12’32.31”E, 349 m a.s.l.); MRSN A6674 (PBZT-RJS 2020), adult female (ethanol-fixed and DNA sequenced), collected by J.E. Randrianirina on 17 October 2008 at Marovato (18°41’09.60”S, 048°36’19.80”E, 692 m a.s.l.); MRSN A6787 (PBZT-RJS 1830), adult male (ethanol-fixed and DNA sequenced), collected by J.E. Randrianirina on 12 October 2008 at Anivorano Est, village d’Ambalatenina, Forêt d’Andrarihitra (18°45’56.94”S, 048°57’07.20”E, 270 m a.s.l.); ZSM 189/2016 (FGZC 5239), juvenile (ethanol-fixed and DNA sequenced), collected by F. Glaw, D. Prötzel and L. Randriamanana, on 1st January 2016 near Analalava-Foulpointe (17°42’25.39”S, 049°27’35.59”E, ca. 30 m a.s.l.).

Diagnosis

(see also Tables 1, 5 and Figs 2–3, 6–8). A microhylid belonging to the subfamily Cophylinae, with connected lateral metatarsalia, short hindlimbs, tibiotarsal articulation not exceeding the nostril, inner metatarsal tubercle present, vomerine teeth present, clavicle absent, knob-shaped terminal phalanges, and males with a single subgular vocal sac; therefore attributed to the genus Plethodontohyla (see Appendix A of Scherz et al. 2016a). The attribution to the genus Plethodontohyla is also supported by molecular phylogenetic evidence from newly collected material (see Fig. 5). The species is characterised by the following suite of characters: (1) moderately large size (male SVL 33.0–40.3 mm; female SVL 36.8–42.2 mm); (2) HW/HL 1.41–1.79; (3) FORL/SVL 0.50–0.57; (4) HIL/SVL 1.24–1.58; (5) TIBL/SVL 0.36–0.40; (6) rounded snout tip; (7) toe tips not enlarged; (8) finger tips not enlarged; (9) knob-shaped terminal phalanges of the fingers and toes; (10) smooth dorsal skin; (11) absence of a distinct dorsolateral colour border; (12) presence of a supratympanic dermal fold; (13) presence of a typically bold and generally white-bordered brown ‘X’ marking on head; (14) tibiotarsal articulation reaching at least the tympanum and (15) TD/ED 0.33–0.52. Furthermore, the species is separated from all nominal taxa in this genus by an uncorrected pairwise distance of at least 5.5% in the sequenced 16S fragment (comparison with P. alluaudi in its new definition and P. sp. Ca01).

Table 5.

Download as

CSV

XLSX

Morphological variation in the analysed specimens of Plethodontohyla spp. Abbreviations not identified in the text: TT, Toe Tips (1, not enlarged, 2, enlarged); FT, Finger Tips (1, not enlarged, 2, enlarged); TP, Terminal Phalanges (K, knob-shaped, T, T-shaped, Y, Y-shaped); DDL, Dorsolateral Line, a narrow white dorsolateral line delimiting a sharp difference between the dorsal colouration and the uniformly dark flanks, extending from the tip of the snout backward until the inguinal region (+, presence, - absence, (+), not always present); Sk, Skin (1, smooth, 2, granular, 3, with tubercles); RID, Ridge, supratympanic dermal fold (+, presence, - absence); X, bold ‘X’ marking on the head between the eye bordered by a thin while line (+, presence, - absence); DDF, Dorsal Dermal Folds, two symmetrical and concave thin dorsal folds (+, presence, - absence); TTA, Tibiotarsal Articulation (1, reaching the tympanum, 2, reaching the insertion of the arms, 3, reaching the eye, 4, extending beyond the eye, * at least); ST, Snout tip (1, rounded, 2, pointed).

ID code	Genus	Species	Locality	Sex	Status	TT	FT	TP	DLL	SK	RID	X	DDF	TTA	ST
SMF 4286	Phrynocara	laeve	Sakana	F	HT	1	1	K	–	1	+	+	–	n/a	1
MRSN A6189	Plethodontohyla	laevis	Betampona	F	–	1	1	K	–	1	+	+	–	1*	1
MRSN A6181	Plethodontohyla	laevis	Betampona	F	–	1	1	K	–	1	+	+	–	1*	1
MRSN A6340	Plethodontohyla	laevis	Betampona	M	–	1	1	K	–	1	+	+	–	1*	1
ZSM 980/2013	Plethodontohyla	laevis	Betampona	M	–	1	1	K	–	1	+	+	–	1*	1
MRSN A6674	Plethodontohyla	laevis	Marovato	F	–	1	1	K	–	1	+	+	–	3	1
MRSN A6787	Plethodontohyla	laevis	Anivorano Est	M	–	1	1	K	–	1	+	+	–	1*	1
MNHN 1901.235	Dyscophus	alluaudi	Fort Dauphin	F	HT	1	1	K	–	1	+	+	–	2	1
MNHN 1936.47	Plethodontohyla	laevis tsianovohensis	Tsianovoha	F	HT	1	1	K	–	1	+	+	–	n/a	1
ZSM 89/2004	Plethodontohyla	alluaudi	Andohahela	–	–	1	1	K	–	1	+	+	–	2*	1
FAZC 15423	Plethodontohyla	alluaudi	Tsitongambarika (Anosyenne Chain)	–	–	1	1	K	–	1	+	+	–	n/a	1
UADBA-A 27994 (FGZC 160)	Plethodontohyla	alluaudi	Andohahela	–	–	1	1	K	–	1	+	+	–	n/a	1
ZCMV 555	Plethodontohyla	sp. Ca01	Ambatolahy	–	–	1	1	n/a	–	n/a	+	+	–	n/a	1
ZSM 855/2006	Plethodontohyla	sp. Ca01	Imaloka	–	–	1	1	K	–	1	+	+	–	1	1
ZSM 856/2006	Plethodontohyla	sp. Ca01	Imaloka	–	–	1	1	K	–	1	+	+	–	1	1
MRSN A3221	Plethodontohyla	tuberata	Manjakatompo	–	–	1	1	K	–	3	+	–	–	2	1
MRSN A2859	Plethodontohyla	ocellata	Ranomafana	–	–	1	1	K	–	2	+	–	–	1*	1
ACZCV 0101	Plethodontohyla	ocellata	Betampona	–	–	1	1	K	–	2	+	–	+	1*	1
ZSM 5204/2005	Plethodontohyla	bipunctata	Andohahela	–	–	1	1	K	–	2	+	–	+	2*	1
ZSM 854/2006	Plethodontohyla	brevipes	Imaloka	–	–	1	1	K	–	2	+	+	+	2	1
MRSN A2476	Plethodontohyla	inguinalis	Kalambatritra	–	–	2	2	T	(+)	2	–	–	–	3*	1
MRSN A5653	Plethodontohyla	notosticta	Sahavontsira	–	–	2	2	T	+	1	–	–	–	3	2
ZSM 61/2005	Plethodontohyla	guentheri	Marojejy	F	HT	2	2	T	+	1	–	–	–	3	2
ZSM 123/2006	Plethodontohyla	fonetana	Tsingy de Bemaraha	F	HT	2	2	Y	–	1	+	–	+	1	1
ZSM 1087/2001	Plethodontohyla	mihanika	Andasibe	M	PT	2	2	T	+	1	–	–	–	4*	2

Plethodontohyla laevis may be distinguished from other members of the genus Plethodontohyla as follows: from P. inguinalis, P. notosticta, P. guentheri, P. mihanika and P. fonetana by non-expanded terminal digits (vs. moderately to strongly expanded) and by its knob-shaped terminal phalanges of the fingers and toes (vs. T- or Y-shaped) and from all these species except P. fonetanaby the absence of a dorsolateral colour border (present in all of these species but only some specimens of P. inguinalis). It also differs from P. notosticta, P. guentheri and P. mihanika by having a rounded snout tip (vs. generally pointed); from P. ocellata, P. bipunctata, P. brevipes, P. inguinalis and P. tuberata by smooth skin (vs. granular or tubercular); from P. inguinalis, P. notosticta, P. guentheri and P. mihanika by the presence of a supratympanic fold running from the posterior border of the eye backward until the forelimb (vs. absence); from all species of Plethodontohyla except P. alluaudi and P. sp. Ca01 by the presence of a bold, mostly white-bordered ‘X’ marking (see Fig. 3 for its variation) on the head (vs. absence); from P. tuberata, P. bipunctata, P. brevipes and P. mihanika by a tibiotarsal articulation reaching at least the tympanum (vs. reaching the insertion of the arms or going beyond the tip of snout in P. mihanika); and from P. ocellata, P. bipunctata, P. fonetana and most individuals of P. brevipes by lacking two symmetrical and concave thin dorsal folds (vs. presence).

Plethodontohyla alluaudi (as newly circumscribed) and P. sp. Ca01 are morphologically the most similar species to P. laevis (see also Figs 3–4). For distinction from P. alluaudi, see the re-description of that species, below. Plethodontohyla laevis differs from P. sp. Ca01 by larger body size (SVL 33.0–42.2 vs. 27.7–31.9 mm) and smaller tympanum (TD/ED 0.33–0.52 vs. 0.55–0.63).

Plethodontohyla laevis also resembles Rhombophryne botabota, R. laevipes, R. mangabensis and R. savaka in external morphology and in some aspects of its colouration. It may be distinguished from all species by the presence of a bold, mostly white-bordered ‘X’ marking on the head (vs. absence), but additionally it may be distinguished from all four of these species by the absence of clavicles; from R. laevipes by its smaller size (SVL 36.8–42.2 mm vs. 44.5–56.3 mm), much shorter leg length (HIL/SVL 1.24–1.58 vs. 1.75–1.86) and absence of white ocelli in the inguinal region (vs. presence); from R. laevipes and R. mangabensis by its smaller tympanum (TD/ED 0.33–0.52 vs. 0.57–0.73); from R. botabota, R. mangabensis and R. savaka by its larger size (SVL 36.8–42.2 mm vs. 20.4–32.2 mm); from R. savaka by its slightly narrower head (HW/HL 1.41–1.79 vs. 1.80), longer relative forelimb length (FORL/SVL 0.50–0.57 vs. 0.43), raised supratympanic fold (vs. not raised) and absence of a diastema in the vomerine teeth (vs. presence); and from R. botabota and R. mangabensis by generally shorter relative tibia length (TIBL/SVL 0.36–40 vs. 0.38–0.45).

Re-description of the holotype

(SMF 4286). Specimen in relatively good state of preservation (Fig. 2a, b). Right forelimb fractured (Fig. 7a, b). Ventrally slit down the midline of the whole body. SVL 38.1 mm (for other measurements, see Table 1). Body moderately enlarged and flattened dorsoventrally; head much wider than long and almost as wide as body; snout rounded in dorsal and lateral view; nostrils directed laterally, slightly protuberant, nearer to tip of snout than to eye; canthus rostralis distinct, concave; loreal region concave; tympanum indistinct, rounded, roughly 40% of eye diameter; supratympanic fold from eye to shoulder distinct and straight; tongue ovoid, very broad, posteriorly free and slightly notched; maxillary teeth present; vomerine teeth distinct, forming oblique transverse rows posterior to choanae, laterally approaching the maxillae and medially almost in contralateral contact; choanae ovoid. Arms robust, fingers bearing marked single subarticular tubercles and hands bearing indistinct paired outer metacarpal tubercles; large, slightly protruding inner metacarpal tubercle; fingers without webbing; relative length of fingers 1<2=4<3, fourth finger roughly equal in length to second; finger disks not enlarged; nuptial pads absent. Hindlimbs robust; tibiotarsal articulation reaching the tympanum when hindlimb adpressed along body; tibia length 38.8% of SVL; lateral metatarsalia connected; distinct inner and less distinct outer metatarsal tubercles present; only traces of webbing between toes; relative length of toes 1<2<5<3<4; third toe distinctly longer than fifth. Skin on dorsum and venter smooth; supratympanic fold whitish. Colour of iris indistinguishable.

Colouration

After more than a century in preservative (holotype collected in September 1904) colouration is faded. Dorsum light brown with darker brown-black spots, markings and presence of a bold X-shaped marking bordered with a white line on the head behind the eye. Colouration of the proximal dorsal portion of the hindlimbs mottled with dark brown markings on a cream background colour; the same colouration extends into the inguinal region. Colouration of the distal dorsal portion of the hindlimbs light brown with faint brown crossbands. Sides of head and tympanic region brownish, with darkener flecks. Ventral skin markedly pigmented: throat and chest mottled brown and cream, abdomen and ventral legs cream, becoming increasingly mottled with faint brown distally. The colouration in life of this specimen is not known.

Osteology

In the following, we describe notable and important diagnostic characters of Plethodontohyla laevis based on SMF 4286 (Figs 2, 6–7) and the newly collected specimen MRSN A6340 (Fig. 8). PDF-embedded 3D models of these skeletons are provided as Suppl. materials 2 and 5.

Figure 7. 

The skeleton of Plethodontohyla laevis (SMF 4286) rendered via micro-CT scanning. (a–b) Full skeleton in (a) dorsal and (b) ventral view. (c–e) Skull in (c) dorsal, (d) ventral and (e) lateral view. Abbreviations: angspl, angulosplenial; col, columella; exoc, exoccipital; exoc.oc, occipital condyle of exoccipital; fpar, frontoparietal; fpardop, frontoparietal dorsal process; max, maxilla; max.pf, pars facialis of maxilla; max.parspal, pars palatina of maxilla; mmk, mentomeckelian; npl, neopalatine; pmax, premaxilla; povom, postchoanal vomer; proot, prootic; prsph, parasphenoid; prsph.al, alary process of parasphenoid; prvom, prechoanal vomer; pter, pterygoid; pter.mr, medial ramus of pterygoid; pter.vr, ventral ramus of pterygoid; qj, quadratojugal; qj.pvp, posteroventral process of quadratojugal; smax, septomaxilla; sq.or, otic ramus of squamosal; sq.vr, ventral ramus of squamosal; sq.zr, zygotic ramus of squamosal; spheth, sphenethmoid. For a 3D rotational model, see Suppl. material 2.

Figure 8. 

Audiospectrogram and corresponding oscillogram of the advertisement call of Plethodontohyla laevis recorded at Betampona Strict Nature Reserve on 18 November 2007 (22:30 h, 21 °C). Calling male MRSN A6340 (top).

Right humerus fractured in SMF 4286. Skeleton of SMF 4286 relatively poorly ossified, such that the carpals, knee and heel joints and pubis are not visible in the micro-CT scans. The skeleton of MRSN A6340 is comparatively well ossified. Vomerine teeth anteriorly convex, long, occupying the whole postchoanal vomer, separated medially by a small gap. Palatine processes of premaxilla subequal in width and length. Prechoanal vomer flat and triradiate, the lateral ramus closer to the anterior end. Premaxilla and maxilla bearing teeth. Nasals large, broad, not in contact with other bones. Sphenethmoid only laterally ossified. Extensive calcification present inside the braincase of MRSN A6340. Posterior ramus of pterygoid extremely long and broad. Transverse ridge across posterior of frontoparietals. Weakly descending lateral flange of frontoparietal. Clavicle absent. Coracoids with weak notches for the attachment of the procoracoid cartilage. Cleithrum broad. Terminal phalanges of fingers knobbed. Finger phalangeal formula 2-2-3-3. Neural spines present on presacrals 2 and 3. Sacrum thin. Iliosacral articulation type IIA/B sensu Emerson (1979). Urostyle bearing a strong, straight dorsal ridge for almost its entire length; articulation bicondylar. Iliac shafts bearing weak dorsal crests; possessing a shallow oblique groove and lacking a dorsal tubercle. Leg bones lacking crests. Toe phalangeal formula 2-2-3-4-3.

Colouration in life based on recently collected material

The colouration in life is remarkably variable. Dorsal colouration is a range of brown tones, while ventral colouration contains elements of grey, black and beige. The most consistent element is a more or less bold, X-shaped marking on the back of the head, with the anterior arms of the X reaching onto the posterior of each eye, and the posterior arms reaching posteriorly to either join the dorsal pattern (typically fading) or remaining clearly distinct in the suprascapular region. This distinctive marking is present in the dorsal colouration also in juveniles (B. Ferrier, personal communication) and is clear in most adults, though it can sometimes be faded and not clearly distinct from the rest of the dorsal colouration. Posterior to this ‘X’, the dorsum is typically dark brown mottled with black, with generally clearly defined, subsymmetrical light brown markings distributed over the dorsum. In some specimens there are also black spots on the flanks. The lateral head is typically light brown (the colour of the dorsal markings), the supratympanic fold somewhat lighter and the tympanum containing a dark spot. In the inguinal region, black spots and light brown spots merge to form lines, but do not form a clearly defined, single black spot as in e.g. P. alluaudi. The dorsal thigh is mottled black with light brown, semi-regular spots, or with moderately defined dark and light crossbands, whereas the dorsal shank is a murky brown with irregular light brown spots or light brown with dark crossbands. The dorsal forelimb is as the shank. The ventral body is beige in base colour, with irregular dark brown mottling over the chin, which can be totally black in males, becoming less regular posteriorly over the abdomen and being free of maculations over the hip. The ventral shank is mostly beige, sometimes with dark spots. A light brown annulus is present before the tip of each finger.

Variation

Morphometric variation is given in Table 1. No remarkable variation in general morphology exists between the holotype and the newly collected material, except that the second finger is shorter than the fourth in newly collected specimens. Colouration variation has been discussed in the above section, and is merely more vivid and distinct in the new material than the holotype. Females lack the single subgular vocal sac that can be highly extensible (Fig. 8). MRSN A6189 and MRSN A6181 are slightly less pigmented than MRSN A6340 and the colouration of the proximal dorsal portion of the hindlimbs (mottled with black markings on a cream background colour) extends forward to lateral midbody and backwards to the tibiotarsal articulation on the ventral side of the hindlimb.

Natural history

Little information is available on this species. The eight new specimens were found active on the ground during the day or during the night, and this species was also found moderately active in dry conditions (after several days of no rainfall). In November 2013 one individual (not collected) was encountered along a drift fence during a rainy night. ZSM 980/2013 was encountered hidden in the leaf litter at the base of a Ravenala madagascariensis and ZSM 189/2016 was active in the leaf litter during the day. No information on the reproductive biology of this species is currently known. In 2007, a group of males were heard calling during rainfall. Individuals were calling from within the leaf litter or at the opening of a burrow, into which they can easily disappear upon detection. The holotype has a nearly intact millipede in its stomach (see Fig. 7). This is the only diet record currently available for this species.

Distribution and conservation status

Plethodontohyla laevis is known from (1) the type locality Sakana (whence no recent records for the species are known), (2) Betampona Natural Reserve, (3) Marovato, (4) Anivorano Est, (5) Analalava-Foulpointe and (6) the Réserve Privée (RP) d’Ambodiriana (only photographic records are available from this locality) (Figs 1–3). All these sites are distributed at low altitudes in the central- to North-East of Madagascar. Altitudinal distributional range reaches from sea level to ca. 700 m a.s.l.. Due to the severe habitat degradation of the lowland rainforest in the northeast of Madagascar it is likely that the species is locally extinct at its type locality. Surveys in Zahamena Natural Reserve so far failed to report this species, but a more thorough investigation of the area is required to confirm the presence or absence of this species in that area. As noted above, the record of the species from the central highland (Ankazobe) is dubious and must be confirmed by further fieldwork in this area and/or examination of the material cited by Blommers-Schlösser (1975).

The species occurs at least in two protected areas, where it seems to be a relatively abundant although it is a species with secretive habits. Nevertheless, its distribution is highly fragmented, its extent of occurrence is quite limited (minimum convex polygon = 9770.92 km²) and it is threatened by on-going habitat destruction. These factors (range under 20,000 km², severely fragmented distribution and on-going habitat destruction) qualify P. laevis as Vulnerable under criterion B1ab(iii) of the IUCN Red List (IUCN 2012).

Acoustic repertoire

Advertisement calls were recorded from a single male (MRSN A6340) at Betampona (Maintimbato: 17°53’35.50”S, 049°13’41.30”E, 283 m a.s.l.) on 18 November 2007, at 22:30 h at an air temperature of 21 °C (Rosa et al. 2011, track #50) (Fig. 8, Table 3). Each call consisted of a single loud note repeated after long, regular intervals, starting as unharmonious sound, but being tonal for most of its duration. They were slightly frequency-modulated in their tonal part and lasted 391–422 ms (407 ± 12.7, n = 4). We recorded one inter-call interval of 47 s. The fundamental frequency of the tonal part was 0.89–1.40 kHz with a dominant frequency band (frequency containing the greatest sound energy) between 1.82–2.53 kHz. Up to 10 harmonics were visible on the spectrogram and no attenuation of any of the harmonics was observed. The call of Plethodontohyla laevis is overall quite similar to the other species of this genus, and also members of the genus Rhombophryne (e.g. Lambert et al. 2017), but seems to have a lower repetition rate. Although we recorded only one of these long inter-call intervals, the recording was made on a rainy night, with more males calling simultaneously, all with long inter-call intervals.

Figs 2c, d, 4a, 6, 9, Suppl. materials 1, 3, 6

Re-description

(based on MNHN 1901.235). Specimen in relatively good state of preservation (Figs 2, 6, 9). A cross-shaped incision made over the pectoral girdle, a lateral incision on the left side and a number of incisions on the lower back. A strong transverse fold is present at the posterior head, certainly a fixation artefact. SVL 47.4 mm (for other measurements, see Table 1). Body large and robust; head much wider than long (HW/HL 1.85) and almost as wide as body; snout rounded in dorsal and lateral view; nostrils directed laterally, slightly protuberant, nearer to tip of snout than to eye; canthus rostralis distinct, concave; loreal region concave, oblique; tympanum slightly distinct, rounded, TD/ED 0.53; supratympanic fold from eye to shoulder distinct and curved; tongue ovoid, very broad, posteriorly free and not notched; mandible damaged at the midline so that the two halves are distinguishable externally; maxillary teeth present; vomerine teeth distinct, forming oblique curved rows posterior to choanae, laterally approaching the maxillae and medially almost in contralateral contact; choanae ovoid. Arms robust, fingers bearing marked single subarticular tubercles and hands bearing indistinct outer metacarpal tubercles; large, protruding inner metacarpal tubercle; fingers without webbing; relative length of fingers 1<2<4<3, fourth finger slightly longer than second; finger disks not enlarged; nuptial pads absent. Hindlimbs robust; tibiotarsal articulation reaching the insertion of the arm when hindlimb adpressed along body; TIBL/SVL 0.34; lateral metatarsalia connected; distinct inner and less distinct outer metatarsal tubercles present; only traces of webbing between toes; relative length of toes 1<2<5<3<4; third toe distinctly longer than fifth. Skin on dorsum smooth; supratympanic fold whitish. Colour of iris indistinguishable.

Figure 9. 

The skeleton of Plethodontohyla alluaudi (MNHN 1901.235) rendered via micro-CT scanning. (a–b) Full skeleton in (a) dorsal and (b) ventral view. (c–e) Skull in (c) dorsal, (d) ventral and (e) lateral view. Abbreviations are as in Fig. 7. For a 3D rotational model, see Suppl. material 1.