Research Article |
Corresponding author: Xiao Chen ( chenxiao2010ouc@163.com ) Academic editor: Nicolas Hubert
© 2022 Xiao Chen, Man Wang, Liang Cao, E Zhang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Chen X, Wang M, Cao L, Zhang E (2022) Gobiobotia lii, a new species of gudgeon (Teleostei, Gobionidae) from the middle Chang-Jiang Basin, central China, with notes on the validity of G. nicholsi Bănărescu & Nalbant, 1966. Zoosystematics and Evolution 98(1): 93-107. https://doi.org/10.3897/zse.98.80547
|
Gobiobotia lii is described from the Qi-Shui, a stream tributary on the northern bank of the middle Chang-Jiang mainstem in Hubei Province and Lake Dongting in Hunan Province, central China. The new species is distinguished from all other congeneric species by possessing a combination of the following characters: a naked region of the abdomen adjacent to the ventral mid-line extending to the vent and the vertebral count (4+31–32). The validity of G. lii is confirmed by its monophyletic nature recovered in a phylogenetic analysis, based on the cyt b gene and its significant sequence divergence with sampled congeneric species. Critical notes were given on the species recognition of historically documented eight-barbel gudgeons co-existing in Lake Dongting. Gobiobotia nicholsi Bănărescu & Nalbant, 1966 should be a valid species distinct from G. filifer (Garman, 1912) and both G. pappenheimi Kreyenberg, 1911 and G. boulengeri (=Xenophysogobio boulengeri (Tchang, 1929)) have an erroneous record from the Lake.
cyt b gene, new taxon, morphology, species identification, taxonomy
The gudgeon genus Gobiobotia Kreyenberg, 1911 (type species G. pappenheimi) comprises about 19 species (
Gobiobotia, especially from China, has a taxonomic inertia despite
Fish surveys were conducted during 2011–2015 and 2017–2018 in Lake Dongting in Hunan Province and during 2021 in some tributaries on the northern bank of the middle Chang-Jiang in Hubei Province, central China. These surveys yielded eighty-five specimens referred to as Gobiobotia, conforming to G. filifer and G. meridionalis, as well as a morphologically and genetically distinct subsample which represents an undescribed species. The present study aims to provide a description of this unnamed species. Some notes on the validity of G. nicholsi and the identification of other historically documented co-existing eight-barbel gudgeons in Lake Dongting are also provided.
Specimens utilised for this study were sampled in accordance with the Chinese Laboratory Animal Welfare and Ethics animal welfare laws (GB/T 35892–2018). After being anaesthetised, all captured individuals were fixed by immersion in ethanol or formalin. Specimens were collected using gill nets, trap nets and electrofishing. Caught specimens of Gobiobotia were stored in 10% formalin for morphological examination or 95% ethyl alcohol for DNA extraction. All sequences amplified in this study were submitted to GenBank. Their voucher specimens are deposited in the collection of the Museum of Aquatic Organisms at the Institute of Hydrobiology (IHB), Chinese Academy of Sciences (
Measurements were taken point to point with a digital caliper connected directly to a data-recording computer and data recorded to the nearest 0.1 mm. Measurements were taken on the left side of specimens whenever possible, following methods used by
Morphometry of Gobiobotia lii. Measurements are in percentage of standard length, except for standard length (SL). SD, standard deviation; r, Pearson’s correlation coefficient; p, significance; linear regression parameters calculated from measurements. HT = Holotype.
Measurements | N | HT | Min | Max | Mean | SD | slope (b) | intercept (a) | r (SL) | p |
---|---|---|---|---|---|---|---|---|---|---|
SL (mm) | 14 | 48.6 | 42.1 | 51.2 | 46.8 | 2.7 | ||||
Body depth | 14 | 22.6 | 15.6 | 22.3 | 19.6 | 2 | 0.5461 | 5.7924 | 0.701 | 0.005 |
Head length | 14 | 25.1 | 22.5 | 25.1 | 23.5 | 0.8 | 0.0124 | 23.043 | 0.037 | 0.9 |
Pre-dorsal length | 14 | 49.5 | 44.7 | 51.2 | 47.4 | 1.7 | -0.029 | 48.906 | -0.04 | 0.883 |
Pre-pectoral length | 14 | 21.3 | 20.4 | 23.2 | 21.9 | 0.9 | -0.154 | 29.126 | -0.47 | 0.091 |
Pre-pelvic length | 14 | 48.7 | 44.9 | 52.9 | 48.1 | 1.9 | -0.1722 | 56.232 | -0.25 | 0.398 |
Pre-anal length | 14 | 74.8 | 70.4 | 78.4 | 74 | 2.4 | -0.0537 | 76.607 | -0.06 | 0.837 |
Dorsal length | 14 | 25.2 | 21.1 | 26 | 24 | 1.6 | 0.3178 | 9.2449 | 0.541 | 0.046 |
Pectoral length | 14 | 22.8 | 18.1 | 23.4 | 21.5 | 1.6 | -0.1957 | 30.756 | -0.34 | 0.24 |
Pelvic length | 14 | 19.6 | 15.9 | 19.6 | 18 | 1.2 | -0.1486 | 24.994 | -0.33 | 0.257 |
Anal length | 14 | 20.1 | 16.2 | 21.4 | 18.4 | 1.4 | -0.0407 | 20.437 | -0.08 | 0.795 |
Pectoral-pelvic distance | 14 | 29.2 | 26 | 30.3 | 28.4 | 1.3 | -0.0534 | 30.95 | -0.11 | 0.705 |
Pelvic-anal distance | 14 | 27.2 | 24.9 | 30 | 27.5 | 1.5 | -0.2996 | 41.551 | -0.54 | 0.046 |
Pelvic-anus distance | 14 | 13.2 | 9.6 | 13.1 | 11.6 | 1.1 | -0.0514 | 14.082 | -0.12 | 0.682 |
Anus-anal distance | 14 | 16.4 | 12.7 | 18.1 | 15.4 | 1.7 | 0.1019 | 10.664 | 0.164 | 0.575 |
Head depth | 14 | 61.6 | 52 | 69.1 | 61.5 | 4.9 | 0.7576 | 39.821 | 0.54 | 0.046 |
Head width | 14 | 73.1 | 65.4 | 80.8 | 75.4 | 3.8 | -0.066 | 64.639 | -0.04 | 0.901 |
Snout length | 14 | 40.1 | 38.9 | 43.2 | 41.8 | 1.1 | 0.007 | 41.347 | 0.017 | 0.955 |
Interorbital width | 14 | 20.8 | 21.1 | 28.6 | 24.6 | 2 | 0.0054 | 24.079 | 0.007 | 0.982 |
Eye diameter | 14 | 19.1 | 20 | 25.8 | 22.5 | 1.7 | -0.2117 | 32.172 | -0.3 | 0.29 |
Maxillary barbel length | 14 | 28.7 | 23.9 | 67.9 | 33 | 10.5 | 0.6906 | 0.2997 | 0.18 | 0.539 |
Post-orbital length | 14 | 33.8 | 31.5 | 46.6 | 39.5 | 5 | -0.355 | 55.727 | -0.19 | 0.526 |
BMNH Natural History Museum, London;
ZMB Museum für Naturkunde-Leibniz Institute for Evolution and Biodiversity Science, Berlin.
Genomic DNA was extracted from fin clips stored in ethanol using the TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing) with the recommended protocol.. The cyt b gene was amplified by using primers L14724 (GACTTGAAAAACCACCGTTG) and H15915 (CTCCGATCTCCGGATTACAAGAC) adopted from
Morphometric measurements for four species of Gobiobotia: G. jiangxiensis, G. pappenheimi, G. meridionalis and G. filifer.
Character | G. jiangxiensis (n = 6) | G. pappenheimi (n = 14) | G. meridionalis (n = 19) | G. filifer (n = 21) | ||||
---|---|---|---|---|---|---|---|---|
Range | Mean±SD | Range | Mean±SD | Range | Mean±SD | Range | Mean±SD | |
SL (mm) | 35.2–52.5 | 40.2±5.8 | 27.9–56.1 | 43.7±8.7 | 54.0–99.5 | 80.4±10.8 | 52.2–96.5 | 75.5±11.7 |
Morphometric data | ||||||||
% of SL | ||||||||
Body depth | 12.2–22.5 | 17.1±3.3 | 27.9–56.1 | 43.7±8.7 | 14.9–20.8 | 17.9±1.5 | 15.4–22.5 | 18.2±1.9 |
Head length | 22.0–25.9 | 24.4±1.3 | 12.5–14.5 | 13.6±0.7 | 24.4–28.1 | 26.7±1.0 | 17.9–28.2 | 25.7±2.1 |
Pre-dorsal length | 46.8–50.5 | 48.6±1.6 | 46.2–51.8 | 49.2±1.6 | 43.8–51.9 | 46.5±2.0 | 41.2–52.7 | 46.8±2.4 |
Pre-pectoral length | 19.8–24.1 | 22.9±1.6 | 18.8–28.1 | 23.6±2.8 | 24.6–27.3 | 26.0±0.9 | 23.2–28.5 | 25.6±1.3 |
Pre-pelvic length | 44.6–50.8 | 48.3±2.3 | 44.7–50.7 | 47.7±1.9 | 45.0–52.4 | 48.3±1.7 | 43.5–51.1 | 47.8±2.0 |
Pre-anal length | 71.0–78.1 | 74.7±2.2 | 69.4–79.0 | 75.2±2.4 | 72.7–77.5 | 75.0±1.4 | 69.0–77.3 | 73.3±2.1 |
Dorsal length | 27.1–31.2 | 28.8±1.6 | 22.8–28.1 | 24.7±1.5 | 23.4–27.5 | 25.6±1.1 | 19.8–25.6 | 23.1±1.6 |
Pectoral length | 25.1–28.2 | 26.5±1.0 | 17.0–22.5 | 20.1±1.6 | 21.9–29.1 | 25.0±1.5 | 22.9–31.8 | 26.1±2.1 |
Pelvic length | 18.1–23.4 | 20.6±1.7 | 16.0–21.4 | 19.2±1.4 | 18.0–22.1 | 20.5±1.2 | 15.2–20.0 | 17.8±1.2 |
Anal length | 18.1–21.3 | 19.1±1.0 | 16.0–21.4 | 19.2±1.4 | 17.5–20.9 | 19.0±0.9 | 15.5–19.2 | 17.0±0.9 |
Pectoral-pelvic distance | 26.3–28.7 | 27.3±0.8 | 22.9–27.1 | 25.1±1.4 | 21.0–28.1 | 24.2±1.7 | 21.9–26.0 | 24.1±1.1 |
Pelvic-anal distance | 24.4–26.1 | 25.5±0.6 | 25.7–31.9 | 28.1±1.9 | 26.9–31.1 | 28.5±1.2 | 23.9–29.9 | 26.2±1.6 |
Pelvic-anus distance | 11.7–14.9 | 12.9±1.1 | 8.2–15.4 | 11.0±1.7 | 9.0–14.5 | 11.8±1.2 | 7.6–13.1 | 10.8±1.3 |
Anus-anal distance | 11.3–14.3 | 12.7±0.9 | 14.0–18.1 | 16.0±1.2 | 14.2–19.6 | 16.8±1.4 | 14.4–19.9 | 16.4±1.6 |
% of HL | ||||||||
Head depth | 54.4–60.3 | 57.1±1.9 | 47.5–59.0 | 53.6±3.7 | 51.3–59.0 | 55.4±2.2 | 47.1–76.1 | 53.9±6.1 |
Head width | 60.9–82.1 | 70.4±6.2 | 51.3–73.2 | 67.4±5.3 | 55.4–70.9 | 63.0±4.0 | 49.8–79.4 | 59.4±7.2 |
Snout length | 40.5–46.4 | 42.6±2.0 | 33.7–41.8 | 38.0±2.0 | 41.6–62.7 | 46.0±4.8 | 34.7–55.1 | 40.2±4.2 |
Interorbital width | 21.5–29.3 | 24.8±2.6 | 17.0–29.1 | 21.8±3.6 | 16.6–29.1 | 21.0±3.8 | 24.9–40.7 | 28.8±3.2 |
Eye diameter | 19.3–25.2 | 22.5±2.0 | 16.1–27.4 | 21.3±3.7 | 22.1–35.8 | 26.0±3.7 | 12.1–23.2 | 16.1±2.6 |
Maxillary barbel length | 15.4–19.0 | 16.9±1.3 | 20.1–45.4 | 31.6±6.9 | 20.3–39.5 | 35.2±2.7 | 25.6–37.4 | 31.1±3.8 |
Post-orbital length | 35.7–38.2 | 37.1±1.0 | 33.5–44.4 | 39.1±2.9 | 32.1–50.4 | 37.2±4.7 | 42.0–60.5 | 46.7±3.7 |
Meristic counts | ||||||||
Lateral-line scales | 38–39 | 38.4±0.5 | 37–39 | 38.1±0.7 | 41–43 | 41.8±0.6 | 40–42 | 40.8±0.7 |
Scale rows above lateral line | 5–6 | 5.5±0.5 | 5–6 | 5.5±0.5 | 5–6 | 5.3±0.4 | 5–6 | 5.6±0.5 |
Pre-dorsal scales | 12 | 12 | 13 | 13 | 12–13 | 12.6±0.5 | 12–13 | 12.8±0.4 |
Circumpeduncular scales | 12 | 12 | 12–13 | 12.4±0.5 | 12 | 12 | 12 | 12 |
The cyt b gene of around 1100 bp base was chosen for phylogenetic analysis. The amplified 48 gene sequences were utilised for molecular phylogenetic analysis along with another 11 GenBank-retrieved sequences of the same gene from six congeneric species and two outgroups (Microphysogobio xianyouensis and M. fukiensis). Detailed information about samples, used here for molecular analysis, is given in Table
Detailed information on specimens used in this study. The species with * means the samples available in GenBank.
Species | Specimen voucher | Sampling location | GenBank no. |
---|---|---|---|
G. lii | IHB201711015435 | Yuanjiang, Hunan Prov. (Lake Dongting, Chang-Jiang) | OM275368 |
G. lii | IHB2017101929 | Yuanjiang, Hunan Prov. (Lake Dongting, Chang-Jiang) | OM275369 |
G. lii | IHB202103050300 | Yuanjiang, Hunan Prov. (Lake Dongting, Chang-Jiang) | OM275370 |
G. lii | IHB202103050303 | Yuanjiang, Hunan Prov. (Lake Dongting, Chang-Jiang) | OM275371 |
G. lii | IHB201801016013 | Yuanjiang, Hunan Prov. (Lake Dongting, Chang-Jiang) | OM275372 |
G. lii | IHB2017097256 | Qichun, Hubei Prov. (Qi-Shui, Chang-Jiang) | OM275373 |
G. lii | IHB2017097257 | Qichun, Hubei Prov. (Qi-Shui, Chang-Jiang) | OM275374 |
G. lii | IHB2017097258 | Qichun, Hubei Prov. (Qi-Shui, Chang-Jiang) | OM275375 |
G. lii | IHB202103050858 | Qichun, Hubei Prov. (Qi-Shui, Chang-Jiang) | OM275376 |
G. lii | IHB202103050859 | Qichun, Hubei Prov. (Qi-Shui, Chang-Jiang) | OM275377 |
G. filifer | IHB201711015758 | Maocaojie, Hunan Prov. (Lake Dongting, Chang-Jiang) | OM275378 |
G. guilingensis | IHB20161062A | Rongshui, Guangxi Prov. (Zhu-Jiang) | OM275379 |
G. tungi | IHB202108056037 | Shangrao, Jiangxi Prov. (Chang-Jiang) | OM275380 |
G. tungi | IHB202108056038 | Shangrao, Jiangxi Prov. (Chang-Jiang) | OM275381 |
G. meridionalis | IHB2017040446 | Hengdong, Hunan Prov. (Xiang-Jiang, Chang-Jiang) | OM275382 |
G. meridionalis | IHB2017040447 | Hengdong, Hunan Prov. (Xiang-Jiang, Chang-Jiang) | OM275383 |
G. meridionalis | IHB2016106403 | Chenxi, Hunan Prov. (Yuan-Jiang, Chang-Jiang) | OM275384 |
G. meridionalis | IHB2016106404 | Chenxi, Hunan Prov. (Yuan-Jiang, Chang-Jiang) | OM275385 |
G. meridionalis | IHB2017104358 | Kaili, Guizhou Prov. (Yuan-Jiang, Chang-Jiang) | OM275386 |
G. meridionalis | IHB2017104362 | Kaili, Guizhou Prov. (Yuan-Jiang, Chang-Jiang) | OM275387 |
G. meridionalis | IHB2017040817 | Nanxiong, Guangdong Prov. (Zhu-Jiang) | OM275388 |
G. meridionalis | IHB2017040832 | Shixing, Guangdong Prov. (Zhu-Jiang) | OM275389 |
G. meridionalis | IHB2017013891 | Suichuan, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275390 |
G. meridionalis | IHB2017013893 | Suichuan, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275391 |
G. meridionalis | IHB201804014151 | Fuzhou, Jiangxi Prov. (Fu-He, Chang-Jiang) | OM275392 |
G. meridionalis | IHB201804014152 | Fuzhou, Jiangxi Prov. (Fu-He, Chang-Jiang) | OM275393 |
G. meridionalis | IHB201707014638 | Ningdu, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275394 |
G. meridionalis | IHB201707012675 | Ningdu, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275395 |
G. meridionalis | IHB201707018995 | Taihe, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275396 |
G. meridionalis | IHB2017075488 | Longnan, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275397 |
G. meridionalis | IHB201707017921 | Shicheng, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275398 |
G. meridionalis | IHB201707017918 | Shicheng, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275399 |
G. meridionalis | IHB201707013207 | Huichang, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275400 |
G. meridionalis | IHB201707012757 | Pingshan, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275401 |
G. meridionalis | IHB2016104697 | Ji’an, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275402 |
G. meridionalis | IHB201707018980 | Taihe, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275403 |
G. meridionalis | IHB201707018994 | Taihe, Jiangxi Prov. (Gan-Jiang, Chang-Jiang) | OM275404 |
G. pappenheimi* | Uncatalogued | Tieling, Liaoning Prov. (Liao-He) | NC032293.1 |
G. naktongensis* | Uncatalogued | Korean Peninsula | JX104484.1 |
G. naktongensis* | Uncatalogued | Korean Peninsula | JX104485.1 |
G. macrocephala* | Uncatalogued | Korean Peninsula | JX046845.1 |
G. macrocephala* | Uncatalogued | Korean Peninsula | JX046846.1 |
G. brevibarba* | Uncatalogued | Korean Peninsula | JX094047.1 |
G. brevibarba* | Uncatalogued | Korean Peninsula | JX094048.1 |
Xenophysogobio boulengeri* | Uncatalogued | Upper Chang-Jiang Basin | AF375868.1 |
Xenophysogobio nudicorpa* | Uncatalogued | Upper Chang-Jiang Basin | NC_025300.1 |
Microphysogobio xianyouensis* | NTOUP 201011-534 | Mulan-Xi, Fujian Prov. | KM999931.1 |
Microphysogobio fukiensis* | NTOUP 2015-10-001 | Shaowu City, Fujian Prov. | KT877353.1 |
PhyloSuite (
Gobiobotia pappenheimi Chen & Cao, 1977: 556 (Lake Dongting), Synonym
Gobiobotia lii is distinct from all other congeneric species, except G. brevirostris Chen & Cao, 1977, G. homalopteroidea Rendahl, 1933, G. jiangxiensis Zhang & Liu, 1995 and G. pappenheimi Kreyenberg, 1911, in having a naked region of the abdomen adjacent to the ventral mid-line extending to or beyond the vent (vs. to or away from the pelvic-fin base) (Figs
Morphometric data for type specimens given in Table
Head depressed and broad. Snout pointed in lateral view and slightly bluntly rounded in dorsal view, longer than post-orbital head. Eyes small and dorsolateral; diameter less than interorbital width. Interorbital space flattened. Some irregular papillae present on the mental region.
Mouth inferior, with opening laterally extending to the vertical line of front edge of nostril. Four pairs of barbels: one pair of maxillary barbels and three pairs of mental barbels. Maxillary barbels extending closely to a vertical line through middle of eye; first pair of mental barbels short, inserted at the same level passing through maxillary-barbel roots and anterior to roots of second mental barbels and reaching anterior margin of eye; second pair of mental barbels extending beyond bases of third pair of mental barbels to hind margin of pre-opercula; third pair of mental barbels long, reaching pectoral-fin insertion.
Fins rays flexible, dorsal fin with 3 simple and 7 (14 specimens examined) branched rays; pectoral fin with 1 simple and 12 (6) or 13 (8) branched rays, extending about two-thirds of the distance to pelvic-fin insertion. Pelvic fin with 1 simple and 7 (14) branched rays, reaching beyond the midway to anal-fin origin and surpassing anus; inserted closer to anal-fin origin than to anterior end of pectoral-fin base; located opposite to that of dorsal-fin base. Anal fin with 3 simple and 6 (14) branched rays; origin equidistant from pelvic-fin insertion and caudal-fin base. Anus positioned closer to the pelvic-fin insertion than to anal-fin origin. Caudal fin moderately forked; lower lobes are longer than upper lobes.
Lateral line complete and almost straight, extending along mid-lateral of body, with 37 (7) or 38 (7) pored scales; scale rows above and below lateral lines 5 and 3; circumpeduncular scales 11 (7) or 12 (7) and pre-dorsal mid-line scales 13 (14). Body covered with moderately-sized scales; no scales on breast and belly in front of vent. Vertebral counts 4+31–32 (modally 4+32, see Fig.
In freshly-collected specimens, head and dorsum of body golden yellow, underside and abdomen golden grey; back and lateral head peppered with dark flecks. Back darker and belly lighter, with a dark spot back of the head, 12–13 dorsal dark brown spots extending along mid-line of dorsum from nape to caudal-fin base and 9–10 large dark brown spots along middle of side from gill opening to caudal-fin base. Fin golden yellow, distal margin hyaline.
In formalin-stored specimens, ground colour slightly faded; body dorsally greyish and ventrally greyish-white; dorsal and lateral dark brown spots not clear and the back of the head becoming yellowish-brown. Dorsal, pectoral, pelvic and anal fins light greyish; caudal fin with numerous narrow dark crossbars (Fig.
No sexual dimorphism was observed in the specimens examined.
Gobiobotia lii is known from the Qi-Shui, a stream tributary to the middle Chang-Jiang mainstem at Qichun County, Hubei (Fig.
The specific epithet is named after Shi-Zhen Li, a native of Qichun County where the holotype and partial paratypes were caught. Li was a well-known medical scientist in the Ming Dynasty, who compiled “Compendium of Materia Medica” (‘本草纲目’ in Chinese) - one of the most valuable pieces of literature of traditional Chinese medicine. He had a typical image as an old man with a long white dense beard, just like the eight-barbel gudgeon. The common Chinese name ‘李氏鳅鮀’ in here proposed for Gobiobotia lii.
A total of 37 cyt b gene sequences from five Chinese species of Gobiobotia: G. filifer (one sequence), G. guilingensis (one), G. lii (10), G. meridionalis (23) and G. tungi (two) were amplified in this study. These sequences were used for phylogenetic analysis along with another 11 GenBank-retrieved sequences from six congeneric species and two out-groups (Microphysogobio fukiensis and M. xianyouensis) (Table
Some of specimens, utilised in Banărescu & Nalbant’s (1966) taxonomic revision of Gobiobotia, are from Huping (now Yueyang City) on Lake Tungting (= Dongting). These specimens were not examined by Chinese workers when they revised species of this genus. In this study, photographic examinations are made on them and also on the holotype of Xenophysogobio boulengeri and Gobiobotia pappenheimi and their topotypical specimens are examined as well.
Main diagnostic characters among G. lii and closely-related eight-barbel gudgeons. Number of specimens examined for vertebrae are given in parentheses.
G. lii Λ | G. brevirostris Λ | G. homalopteroidea ○ | G. jiangxiensis Λ | G. pappenheimi Λ | |
---|---|---|---|---|---|
1. Scaleless region of the abdomen adjacent to the ventral mid-line | To anus | To anus | To anal-fin origin | To anus | To anus |
2. Snout length/post-orbital head length | > 1 | < 1 | < 1 | > 1 | > 1 |
3. Eye diameter/interorbital width | < 1 | > 1 | < 1 | > 1 | < 1 |
4. Pupil shape | Round | Elliptical | Round | Round | Round |
5. Eye diameter % of HL | 20.0–25.8 | 20.0–26.3 | 10.8–13.9 | 19.3–25.2 | 16.1–27.4 |
6. Maxillary-barbel length/eye diameter | > 1 | < 1 | > 1 | < 1 | > 1 |
7. Extension of third pair of mental barbel | To base of pectoral fin | To middle of opercula | To base of pectoral fin | To front margin of pre-opercula | To base of pectoral fin |
8. Pectoral-fin length/distance between pectoral- and pelvic-fin insertions | < 1 | < 1 | < 1 | < 1 | > 1 |
9. Second branched pectoral-fin ray | Not elongated | Elongated | Not elongated | Not elongated | Elongated |
10. Vertebral counts | 4+31–32 (3) | 4+34 (2) | 4+36–37 | 4+33–34 (6) | 4+34–35 (5) |
11. Lateral-line pored scales | 37–38 (14) | 38–39 (2) | 41–43 | 38–39 (6) | 37–39 (14) |
Both the holotype (
Nineteen specimens (
Two small specimens (
The generic concept of Gobiobotia still remains contentious. All eight-barbel gudgeons were traditionally classified into three subgenera, namely Gobiobotia, Progobiobotia and Xenophysogobio (
Species of the gudgeon genus Gobiobotia are subdivided into two groups, based on body squamation. One group includes those species with a naked region of the abdomen adjacent to the ventral mid-line, extending to the vent or even the anal-fin origin. Four species, along with G. lii, are placed in the group: G. brevirostris, G. homalopteroidea, G. jiangxiensis and G. pappenheimi. The rest of congeneric species are assigned to the other group defined by having an unscaled region of the abdomen adjacent to the ventral mid-line extending to or away from the pelvic-fin base. There are marked variations of the new species with the most similar species, G. homalopteroidea and G. pappenheimi, which are provided in the diagnosis. Gobiobotia brevirostris is presently known only from the upper Han-Jiang of the middle Chang-Jiang Basin, while G. jiangxiensis occurs in the Xin-Jiang, an effluent of Lake Poyang. The new species is further distinct from the two co-existing species in having 4+31–32 (vs. 4+33–35) vertebrae, the smaller eyes (diameter less than the interorbital width), maxillary barbels longer than the eye diameter and the third pair of longer mental barbels extending to the pectoral-fin insertion; from G. brevirostris in having a longer (vs. shorter) snout than post-orbital head and relatively smaller (vs. larger) eye diameter than interorbital width; and from G. jiangxiensis in having longer (vs. shorter) maxillary barbels than the eye diameter and the third pair of mental barbels extending to the pectoral-fin insertion (vs. to the front margin of the pre-opercula) (See Table
Some of type specimens of G. lii were collected from Lake Dongting where five nominal species of eight-barbel gudgeons have been documented: G. boulengeri (= Xenophysogobio boulengeri), G. filifer, G. meridionalis, G. nicholsi and G. pappenheimi (
One small specimen of 37.5 mm SL caught from Lake Dongting was referred to as a distinct species by
Based on the above analysis, it is here concluded that Lake Dongting harbours four eight-barbel gudgeons: G. filifer, G. lii, G. meridionalis and G. nicholsi. The new species is separated from all other three co-existing congeneric species by the presence of a naked region of the abdomen adjacent to the ventral mid-line extending to the vent (vs. extending away from or to the pelvic-fin base). It lacks an elongated tip of the second branched pectoral-fin ray typical for G. filifer and has 37–38 lateral-line pored scales fewer than 44–45 and 40–43 for G. nicholsi and G. meridionalis, respectively.
The validity of G. lii is further affirmed by its monophyletic nature recovered in cyt b gene-based phylogenetic analysis and its significant sequence variation on all sampled congeners. In the BI trees (Fig.
Genetic distances (uncorrected p-distance) of cyt b gene computed by MEGA 11 amongst 11 species.
Species | Within Group | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 |
---|---|---|---|---|---|---|---|---|---|---|---|
1. G. lii | 0.0076 | ||||||||||
2. G. naktongensis | 0.0078 | 0.0260 | |||||||||
3. G. pappenheimi | n/c | 0.0387 | 0.0350 | ||||||||
4. G. filifer | n/c | 0.1296 | 0.1212 | 0.1395 | |||||||
5. G. meridionalis | 0.0029 | 0.1358 | 0.1356 | 0.1352 | 0.1424 | ||||||
6. G. guilingensis | n/c | 0.1721 | 0.1649 | 0.1824 | 0.1575 | 0.1805 | |||||
7. G. tungi | 0.0029 | 0.1736 | 0.1660 | 0.1757 | 0.1856 | 0.1890 | 0.1925 | ||||
8. G. brevibarba | 0.0029 | 0.1826 | 0.1835 | 0.1853 | 0.1926 | 0.1864 | 0.2009 | 0.1927 | |||
9. G. macrocephala | 0.0019 | 0.1856 | 0.1776 | 0.1814 | 0.1684 | 0.1740 | 0.1881 | 0.1993 | 0.1631 | ||
10. X. boulengeri | n/c | 0.1833 | 0.1849 | 0.1800 | 0.1787 | 0.1804 | 0.1979 | 0.1935 | 0.1914 | 0.1915 | |
11. X. nudicorpa | n/c | 0.1964 | 0.1822 | 0.1847 | 0.1996 | 0.1883 | 0.1912 | 0.2209 | 0.1199 | 0.2070 | 0.1199 |
G. abbreviata: IHB2113-2117, 5 specimens, 53.4–74.8 mm SL, Min-Jiang at Leshan City, Sichuan Province, China.
G. brevibarba:
G. brevirostris:
G. filifer:
G. guilingensis:
G. jiangxiensis:
G. macrocephala:
G. meridionalis:
G. naktongensis:
G. nicholsi:
G. pappenheimi: ZMB 18466, holotype, 45.0 mm SL, Tianjin City, China (X-radiograph examined); BMNH 1925.8.6.36, Russia (X-radiograph examined);
G. tungi:
Xenophysogobio boulengeri:
All procedures described in this paper were in accordance with Chinese laws and were licensed by the Ministry of Ecology and Environment of the People’s Republic of China.
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
The authors declare that they have no competing interests.
This study was granted by special fund of Program for Biodiversity Investigation & Assessment Project for Biodiversity Conservation of Lake Dongting (Grant No. 2016HB2096001006) and National Science & Technology Fundamental Resources Investigation Program of Mount Dabie (Grant No. 2019FY101800).
Xiao Chen and Man Wang conceived the study and analysed the data. Xiao Chen led the writing. Liang Cao and E Zhang revised the manuscript. All authors contributed to the writing of the paper.
Our sincere thanks should be given to Prof. Jian-Zhong Shen (HZAU, Huazhong Agricultural University) and Hong Li (Hunan Fisheries Science Institute) for assisting us in fieldworks and Wei-Han Shao, Zi-Tong Wang, Dong-Ming Guo, Xiong Gong and Yi Liu (