Research Article
Print
Research Article
Pseudechiniscus in Japan: re-description of Pseudechiniscus asper Abe et al., 1998 and description of Pseudechiniscus shintai sp. nov.
expand article infoKatarzyna Vončina‡, Reinhardt M. Kristensen§, Piotr Gąsiorek‡
‡ Jagiellonian University, Kraków, Poland
§ University of Copenhagen, Copenhagen, Denmark

Corresponding author: Piotr Gąsiorek ( piotr.lukas.gasiorek@gmail.com )

Academic editor: Pavel Stoev
© 2020 Katarzyna Vončina, Reinhardt M. Kristensen, Piotr Gąsiorek.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Vončina K, Kristensen RM, Gąsiorek P (2020) Pseudechiniscus in Japan: re-description of Pseudechiniscus asper Abe et al., 1998 and description of Pseudechiniscus shintai sp. nov. Zoosystematics and Evolution 96(2): 527-536. https://doi.org/10.3897/zse.96.53324
ZooBank: urn:lsid:zoobank.org:pub:F79B0B2D-728D-4A3D-B3C3-06A1C3405F00
Open Access

Abstract

The classification and identification of species within the genus Pseudechiniscus Thulin, 1911 has been considered almost a Sisyphean work due to an extremely high homogeneity of its members. Only recently have several contributions made progress in the taxonomy feasible through their detailed analyses of morphology and, crucially, by the re-description of the ancient, nominal species P. suillus (Ehrenberg, 1853). Herein, we focus on the Japanese representatives of this genus: P. asper, a rare species originally described from Hokkaido, and a new species P. shintai. Both taxa belong to the widespread suillus-facettalis complex. Detailed descriptions entailing DNA barcoding of four markers and illustrations of the ventral pillar patterns are indispensable for an accurate delineation of species within this genus.

Key Words

biodiversity, Echiniscidae, Heterotardigrada, morphology, sculpturing

Introduction

Tardigrades are poorly known micrometazoans famous for their ability to enter cryptobiosis (Møbjerg et al. 2011). This phylum is now widely accepted as a lineage within the superclade Ecdysozoa (Campbell et al. 2011) and related to the Onychophora and Arthropoda within the Panarthropoda (Giribet and Edgecombe 2017). In the last decade, tens of new species have been described, which reflects limited understanding of tardigrade diversity (Bartels et al. 2016). Studies on the Japanese tardigrades have a long history, resulting in over 150 species reported from this archipelago (Suzuki 2017). Amongst them, ca. 40 spp. (> 20%) belong to the limno-terrestrial heterotardigrade family Echiniscidae (Gąsiorek et al. 2018a, Suzuki et al. 2018), a distinct group characterised by the development of cuticular plates on the dorsal surface of the body (Kristensen 1987).

Recent advances in the taxonomy of one of the echiniscid genera, Pseudechiniscus Thulin, 1911, are a good illustration of the progress currently being made in the classification of tardigrades. Firstly, Tumanov (2020) discussed and re-organised the morphological nomenclature after a meticulous analysis of various members of Pseudechiniscus and he concluded that several species are unidentifiable, according to current taxonomic standards. Cesari et al. (2020) demonstrated high genetic variability amongst members of the speciose suillus-facettalis complex, implying that the species richness in the genus may be underestimated. Finally, the ability to confidently describe new Pseudechiniscus species was enabled by the modern diagnosis of P. suillus (Ehrenberg, 1853), one of enigmatic tardigrade taxa described in the 19th century (Grobys et al. 2020). In summary, better understanding of morphology, genetic disparities and ontogenetic shifts (Gąsiorek et al. 2019, Morek et al. 2019) has facilitated intensification in tardigrade research.

In this contribution, we concentrate on the Japanese Pseudechiniscus species. Pseudechiniscus asper Abe et al., 1998 is re-described and P. shintai sp. nov. is described, based on specimens from Aomori Prefecture (Northern Honshu). A brief review of Japanese Pseudechiniscus records is provided, concluding that they should be treated as unreliable and require formal confirmation through a new, large-scale sampling effort undertaken throughout Japan. Such a conclusion is in line with new discoveries of species complexes in numerous tardigrade genera (e.g. Guidetti et al. 2019, Stec et al. 2020, Roszkowska et al. 2020).

Materials and methods

Sample collection and processing

Specimens belonging to two species of the genus Pseudechiniscus were extracted from four moss samples (JP.012–5) collected from trees in Asamushi, Northern Honshu, Japan (ca. 40°54'03.6"N, 140°51'58"E, 30 m a.s.l.; R.M. Kristensen leg. on 24 July 2019). Samples were processed according to the protocol developed by Dastych (1980) with further amendments by Stec et al. (2015). The animals were used in two analyses: (I) qualitative and quantitative morphology, investigated under phase contrast microscopy (PCM) and (II) DNA sequencing (see descriptions for details). Each specimen was observed in a drop of distilled water on a temporary slide under a 400× magnification to confirm its identification prior to analysis.

Microscopy, imaging and morphometrics

Permanent microscope slides were made using Hoyer’s medium and examined using an Olympus BX53 PCM associated with an Olympus DP74 digital camera. All figures were assembled in Corel Photo-Paint X7. All measurements are given in micrometres (μm) and were performed under PCM. Structures were measured only when not broken, deformed or twisted and their orientations were suitable. Body length was measured from the anterior to the posterior end of the body, excluding the hind legs. The sp ratio is the ratio of the length of a given structure to the length of the scapular plate expressed as a percentage (Dastych 1999). Morphometric data were handled using the Echiniscoidea ver. 1.3 template, available from the Tardigrada Register, www.tardigrada.net (Michalczyk and Kaczmarek 2013). Importantly, all species designated as dubious or with insufficient descriptions (Grobys et al. 2020, Tumanov 2020), were discarded from the differential diagnoses.

Genotyping and genetic comparisons

DNA was extracted from individual animals following a Chelex 100 resin (Bio-Rad) extraction method (Casquet et al. 2012, Stec et al. 2015). Hologenophores were obtained for both species (Pleijel et al. 2008). Four DNA fragments were sequenced: three nuclear and one mitochondrial (Table 1) in the case of P. shintai sp. nov.; and three for P. asper. The COI fragment was amplifiable for P. asper but, due to a high number of double peaks, effective sequence cleaning was not possible. All fragments were amplified and sequenced, according to the protocols described in Stec et al. (2015). The obtained alignments were edited and checked manually in BioEdit v7.2.6.1 (Hall 1999) and ClustalW Multiple Alignment tool (Thompson et al. 1994) was used in the alignment of COI for P. shintai sp. nov. and other confidently identified species (Grobys et al. 2020, Roszkowska et al. 2020). MEGA7.0.26 (Kumar et al. 2016) was used for calculation of uncorrected pairwise distances (Srivathsan and Meier 2012).

Table 1.
Download as
CSV
XLSX

Primers and references for specific protocols for amplification of the four DNA fragments sequenced in the study.

DNA fragment Primer name Primer direction Primer sequence (5’-3’) Primer source PCR programme*
18S rRNA 18S_Tar_Ff1 forward AGGCGAAACCGCGAATGGCTC Stec et al. (2017) Zeller (2010)
18S_Tar_Rr2 reverse CTGATCGCCTTCGAACCTCTAACTTTCG Gąsiorek et al. (2017)
28S rRNA 28S_Eutar_F forward ACCCGCTGAACTTAAGCATAT Gąsiorek et al. (2018b) Mironov et al. (2012)
28SR0990 reverse CCTTGGTCCGTGTTTCAAGAC Mironov et al. (2012)
ITS-1 ITS1_Echi_F forward CCGTCGCTACTACCGATTGG Gąsiorek et al. (2019) Wełnicz et al. (2011)
ITS1_Echi_R reverse GTTCAGAAAACCCTGCAATTCACG
COI bcdF01 forward CATTTTCHACTAAYCATAARGATATTGG Dabert et al. (2008) Wełnicz et al. (2011)
bcdR04 reverse TATAAACYTCDGGATGNCCAAAAAA

* – All PCR programmes are also provided in Stec et al. (2015).

Results

Systematic account

Phylum: Tardigrada Doyère, 1840

Class: Heterotardigrada Marcus, 1927

Order: Echiniscoidea Richters, 1926

Family: Echiniscidae Thulin, 1928

Genus: Pseudechiniscus Thulin, 1911

Pseudechiniscus asper Abe, Utsugi & Takeda, 1998

Figures 1, 2, 5A, Tables 2, 3

Locus typicus and type material

ca. 42°46'N, 141°24'E, 250 m a.s.l.; vicinity of the Lake Shikotsu (Chitose, South-western Hokkaido, Japan); foliose lichen Phaeophyscia imbricata (Physciaceae) on the trunk of a maple (Acer japonicum). Collector: Kazuo Utsugi. Holotype: adult male on the slide NSMT-Tg 44 deposited in the National Museum of Nature and Science in Tokyo.

Additional material. Four females on the slides JP.012.01, JP.013.01–2, JP.014.01 and a male on the slide JP.012.04. Hologenophores: JP.012.01, 4, JP.013.02.

Etymology

From Latin asper = rough, referring to the irregular surface of dorsal plates. Adjective in the nominative singular.

Description

Mature females (i.e. from the third instar onwards; measurements in Table 2). Body dark orange, with round black eyes present or dissolving soon after mounting (Fig. 1A, B). Member of the suillus-facettalis complex: dome-shaped (hemispherical) cephalic papillae (secondary clavae) and minute (primary) clavae; peribuccal cirri with poorly developed cirrophores. Cirrus A short, with cirrophore.

Figure 1. 

Habitus of Pseudechiniscus asper (PCM): A, B – females; C – male hologenophore. Insert shows claws III. Arrowheads indicate thickenings at the lateral positions C and D. List of abbreviations: c – caudal plate, cA – cirrus A, ce – cirrus externus, ci – cirrus internus, cp – cephalic plate, m1–3 – median plates, ps – pseudosegmental plate IV’, sI–II – paired segmental plates, sc – scapular plate. Scale bars: in μm.

Table 2.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of mature females of Pseudechiniscus asper mounted in Hoyer’s medium (N – number of specimens/structures measured, RANGE refers to the smallest and the largest structure amongst all measured specimens; SD – standard deviation).

CHARACTER N RANGE MEAN SD
µm sp µm sp µm sp
Body length 2 178 – 203 712 – 810 191 761 18 70
Scapular plate length 2 25.0 – 25.1 – 25.1 – 0.1 –
Head appendages lengths
Cirrus internus 3 9.2 – 11.4 42.0 – 45.4 10.4 43.7 1.1 2.4
Cephalic papilla 3 3.5 – 4.7 13.9 – 18.8 4.1 16.4 0.6 3.4
Cirrus externus 3 14.8 – 19.4 59.2 – 77.3 16.6 68.2 2.5 12.8
Clava 3 4.3 – 5.9 17.2 – 20.3 5.1 18.8 0.8 2.2
Cirrus A 3 24.1 – 30.8 96.4 – 122.7 27.3 109.6 3.4 18.6
Cirrus A/Body length ratio 2 14% – 15% – 14% – 1% –
Papilla on leg IV length 4 3.0 – 3.6 12.0 – 13.9 3.4 13.0 0.3 1.4
Claw 1 heights
Branch 4 8.8 – 10.7 40.2 – 40.4 9.9 40.3 0.8 0.1
Spur 4 1.2 – 1.8 4.8 – 6.4 1.6 5.6 0.3 1.1
Spur/branch length ratio 3 12% – 20% – 16% – 4% –
Claw 2 heights
Branch 3 8.5 – 9.8 38.0 – 39.0 9.3 38.5 0.7 0.7
Spur 3 1.2 – 1.4 4.8 – 5.2 1.3 5.0 0.1 0.3
Spur/branch length ratio 3 13% – 16% – 14% – 2% –
Claw 3 heights
Branch 2 9.2 – 10.1 36.8 – 40.2 9.7 38.5 0.6 2.4
Spur 2 1.0 – 1.8 4.0 – 7.2 1.4 5.6 0.6 2.2
Spur/branch length ratio 2 11% – 18% – 14% – 5% –
Claw 4 heights
Branch 2 11.6 – 11.6 46.2 – 46.2 11.6 46.2 0.0 ?
Spur 2 2.0 – 2.0 8.0 – 8.0 2.0 8.0 0.0 ?
Spur/branch length ratio 2 17% – 17% – 17% – 0% –

Dorsal plates well-sclerotised as for a Pseudechiniscus species, clearly demarcated from each other, with Pseudechiniscus-type sculpturing, i.e. large endocuticular pillars protruding through the epicuticle and visible as dark dots in PCM (Fig. 2A). Striae absent. The cephalic plate pentapartite, with the anterior bi-halved portion and three posterior portions, roughly equal in size (Fig. 1A, B). The cervical (neck) plate absent. The scapular plate with a transverse suture, separating a broader anterior portion and narrower posterior portion (Figs 1B, 2A). Three median plates: m1–2 bipartite, with much reduced, narrow posterior portions, m3 unipartite and large (Fig. 2A) with two pairs of lateral intersegmental platelets flanking the borders of m1–2. Two pairs of large segmental plates, their posterior portions exhibiting thickenings at positions C and D – the latter usually more pronounced (Figs 1A, B, 2). The pseudosegmental plate IV’ divided by a median longitudinal suture; the posterior margin of the plate with a pair of short triangular projections (Figs 1A, B, 2A). The caudal (terminal) plate with short incisions that may be sclerotised (compare Fig. 1A with Fig. 1B).

Figure 2. 

Sculpturing of Pseudechiniscus asper (PCM): A – dorsal; B – ventral. White arrowheads indicate thickenings at the lateral positions C and D, black arrowheads indicate claw spurs and empty arrows indicate papillae IV. Scale bars: in μm.

Ventral cuticle with a faint species-specific pattern reaching the lateroventral sides of the body (Figs 2B, 5A), being a typical reticulum composed of large multiangular, longitudinal shapes connected by belts of pillars. Pillars are particularly poorly visible between legs I and II (Fig. 2B). The subcephalic zone with a wide patch of pillars (Fig. 5A). Sexpartite gonopore located anteriorly of legs IV and a trilobed anus between legs IV.

Pedal plates and dentate collar IV absent; instead, large patches of pillars are present centrally on each leg (Fig. 1A, B). Pulvini indistinct. No papilla or spine on leg I visible in PCM, a papilla on leg IV present (Figs 1B, 2). Claws IV higher than claws I–III; internal claws with needle-like spurs positioned at ca. 1/4–1/5 of the claw height (Fig. 1A, insert).

Mature males (i.e. from the second instar onwards; measurements in Table 3). Smaller than females, with slender body (Fig. 1C). Cirri externi approaching the length of cirri A. Pseudosegmental projections in the form of teeth or wide lobes. Gonopore circular.

Juveniles. Unknown.

Larvae. Unknown.

Eggs. Unknown.

Table 3.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of mature males of Pseudechiniscus asper mounted in Hoyer’s medium. Measurements of the holotype taken from Abe et al. (1998).

CHARACTER ♂ Holotype
µm sp µm
Body length 159 675 166
Scapular plate length 23.5 – ?
Head appendages lengths
Cirrus internus 11.4 48.5 8.0
Cephalic papilla 4.7 20.0 ?
Cirrus externus 14.8 63.0 12.0
Clava 3.5 14.9 1.5
Cirrus A 19.4 82.6 20.0
Cirrus A/Body length ratio 12% – 12%
Papilla on leg IV length 3.7 15.7 ?
Claw 1 heights
Branch ? ? ca. 9.0
Spur ? ? ?
Spur/branch length ratio ? – ?
Claw 2 heights
Branch 11.1 47.2 ca. 9.0
Spur 0.9 3.8 ?
Spur/branch length ratio 8% – ?
Claw 3 heights
Branch 10.9 46.4 ca. 9.0
Spur ? ? ?
Spur/branch length ratio ? – ?
Claw 4 heights
Branch 13.1 55.7 ca. 11.0
Spur 1.0 4.3 ?
Spur/branch length ratio 8% – ?

DNA sequences

Single haplotypes in 18S rRNA (MT645083, 843 bp), 28S rRNA (MT645081, 716 bp) and ITS-1 (MT645085, 631 bp) were obtained.

Remarks

This is the third record of this very rare species, which, in addition to the type locality, has also been found on Mount Taibai, Shaanxi, China (Li et al. 2005). In the original description, only one male was found to possess triangular projections, ending with papillate tips, on the pseudosegmental plate (Abe et al. 1998). However, the variability in the shape of the pseudosegmental projections has previously been noted (Fontoura et al. 2010), thus the lobate form of these structures in the Chinese and Japanese (Honshu) specimens is not surprising. Moreover, Abe et al. (1998) did not illustrate the complete ventral pattern of this species (most likely because of the quality of the microscope used) and omitted the swelling or thickening of the armour at position C, which is weakly developed in this species. As Asamushi lies only ca. 200 km southwards from the shores of Lake Shikotsu (however, the Blakiston’s Line was designated to separate faunae of large vertebrates of Honshu and Hokkaido; see Kawamura 2007), the formal amendments to the original description presented here are justified given that DNA barcodes compensate the scarcity of specimens used in morphometrics.

Phenotypic differential diagnosis

Taxa most similar to P. asper, i.e. those possessing pseudosegmental projections, can be easily distinguished from this species, based on the presence of striae (even rudimentary striae are absent in P. asper; see Fig. 2 in Fontoura et al. 2010 for microphotographs of other species), and/or by the lack of thickenings at the lateral positions (Abe et al. 1998).

Pseudechiniscus shintai sp. nov.

http://zoobank.org/1BC6B3B3-16EF-4442-AD6D-CCD357C47C31
Figures 3, 4, 5B, Tables 4, 5

Locus typicus and type material

ca. 40°54'03.6"N, 140°51'58"E, 30 m a.s.l.; Asamushi-Onsen Forest Park (Aomori, Northern Honshu, Japan); mosses from tree trunks. Collector: R.M. Kristensen. Holotype and allotype: mature female and male on slide JP.013.01. Eight juveniles on the slides JP.012.02–3, JP.013.03–4, JP.014.01–3, JP.015.01. Hologenophores: JP.012.02–3, JP.013.03–4. Holotype, allotype and the majority of paratypes (slides JP.012.02–3, JP.013.01, JP.013.03–4 and JP.015.01) are deposited in the Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland; other paratypes (slides JP.014.01–3; NHMD–669705–7) are deposited in the Natural History Museum of Denmark, University of Copenhagen, Denmark.

Etymology

The name is a patronym honouring Shinta Fujimoto, an excellent Japanese tardigradologist specialising in marine Heterotardigrada. Noun in the genitive singular.

Description

Mature female (i.e. the third or latter instar; measurements in Table 4). Body orange, with minute, round black eyes that are absent after mounting (Figs 3A, 4A). Member of the suillus-facettalis complex: dome-shaped (hemispherical) cephalic papillae (secondary clavae) and minute (primary) clavae; peribuccal cirri with poorly developed cirrophores. Cirrus A short, with cirrophore.

Figure 3. 

Habitus of Pseudechiniscus shintai sp. nov. (PCM): A – female (holotype); B – male (allotype). Insert shows claws I. Scale bars: in μm.

Table 4.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of mature female (holotype) and male (allotype) of Pseudechiniscus shintai sp. nov. mounted in Hoyer’s medium.

CHARACTER Holotype ♀ Allotype ♂
µm sp µm sp
Body length 196 735 178 754
Scapular plate length 26.7 – 23.6 –
Head appendages lengths
Cirrus internus 6.8 25.5 8.2 34.7
Cephalic papilla 4.0 15.0 3.5 14.8
Cirrus externus 12.8 47.9 12.5 53.0
Clava 5.0 18.7 4.0 16.9
Cirrus A 23.1 86.5 25.3 107.2
Cirrus A/Body length ratio 12% – 14% –
Papilla on leg IV length 3.1 11.6 2.3 9.7
Claw 1 heights
Branch 8.7 32.6 7.3 30.9
Spur 2.2 8.2 1.4 5.9
Spur/branch length ratio 25% – 19% –
Claw 2 heights
Branch 8.7 32.6 7.0 29.7
Spur 2.0 7.5 1.6 6.8
Spur/branch length ratio 23% – 23% –
Claw 3 heights
Branch 8.8 33.0 7.2 30.5
Spur 1.9 7.1 1.1 4.7
Spur/branch length ratio 22% – 15% –
Claw 4 heights
Branch 9.2 34.5 8.8 37.3
Spur 1.7 6.4 1.8 7.6
Spur/branch length ratio 18% – 20% –

Dorsal plates poorly sclerotised, but clearly demarcated from each other, with the Pseudechiniscus-type sculpturing, i.e. endocuticular pillars protruding through the epicuticle and visible as dark dots in PCM (Fig. 4A). Striae absent; epicuticular ornamentation visible as darker belts on all dorsal plates. The cephalic plate pentapartite, with the two anterior portions and three posterior portions approximately equal in size (Fig. 4A). The cervical (neck) plate absent. The scapular plate with sutures, separating a wide anterior portion from the four posterior portions (Fig. 4A). Three median plates: m1–2 bipartite; m3 unipartite (Figs 3A, 4A); four pairs of lateral intersegmental platelets flanking the borders of m1–2. Two pairs of large segmental plates. The pseudosegmental plate IV’ divided by a median longitudinal suture; the posterior margin of the plate can be wide (Fig. 4A), but without lobes or teeth (Fig. 3A). The caudal (terminal) plate with short sclerotised incisions (Figs 3A, 4A).

Figure 4. 

Sculpturing of Pseudechiniscus shintai sp. nov. (PCM): A – dorsal; B – ventral. Scale bars: in μm.

Ventral cuticle with a pronounced species-specific pattern reaching the lateroventral sides of the body (Figs 4B, 5B), being a typical reticulum composed of large multiangular, longitudinal shapes joined by belts of pillars. The subcephalic zone with a wide belt of pillars. Sexpartite gonopore located anteriorly of legs IV and a trilobed anus between legs IV.

Figure 5. 

Schematic drawings of ventral sculpturing patterns: A – Pseudechiniscus asper; B – Pseudechiniscus shintai sp. nov.

Pedal plates and dentate collar IV absent, instead large patches of pillars are present centrally on each leg (Fig. 3A). Pulvini indistinct. A papilla on leg I undetectable in PCM and a papilla on leg IV present, but scarcely visible. Claws I–IV of similar heights. External claws on all legs smooth. Internal claws with minuscule, thin spurs positioned at ca. 1/5 of the claw height. (Fig. 3A, insert).

Mature male (i.e. the second or latter instar; measurements in Table 4). No significant differences from females (Fig. 3B). Gonopore circular.

Juveniles (i.e. the second instar; measurements in Table 5). A morphometric gap exists between adult females and juveniles. Phenotypically similar to adults. Gonopore absent.

Larvae. Unknown.

Eggs. Unknown.

Table 5.
Download as
CSV
XLSX

Measurements [in µm] of selected morphological structures of juveniles of Pseudechiniscus shintai sp. nov. mounted in Hoyer’s medium (N – number of specimens/structures measured, RANGE refers to the smallest and the largest structure amongst all measured specimens; SD – standard deviation).

CHARACTER N RANGE MEAN SD
µm sp µm sp µm sp
Body length 6 93 – 172 597 – 730 144 682 27 49
Scapular plate length 7 13.2 – 24.1 – 21.7 – 3.6 –
Head appendages lengths
Cirrus internus 7 5.2 – 8.9 22.7 – 37.4 7.1 31.2 1.2 5.2
Cephalic papilla 6 2.0 – 4.3 11.9 – 18.4 3.0 14.5 0.8 2.2
Cirrus externus 7 6.1 – 12.1 41.9 – 51.7 10.0 46.8 1.9 3.6
Clava 2 3.9 – 4.4 17.6 – 18.8 4.2 18.2 0.4 0.8
Cirrus A 4 17.1 – 26.0 84.2 – 111.1 22.2 96.8 3.7 11.0
Cirrus A/Body length ratio 3 12% – 16% – 14% – 2% –
Papilla on leg IV length 4 2.9 – 3.9 12.6 – 16.5 3.3 14.3 0.5 1.6
Claw 1 heights
Branch 5 5.9 – 7.8 30.5 – 44.7 7.1 34.9 0.7 5.6
Spur 5 0.9 – 1.7 5.9 – 7.4 1.4 6.7 0.3 0.5
Spur/branch length ratio 5 15% – 23% – 20% – 3% –
Claw 2 heights
Branch 6 6.7 – 8.9 30.1 – 37.2 7.7 33.2 0.8 2.3
Spur 6 1.1 – 1.7 5.1 – 7.1 1.4 5.9 0.2 0.8
Spur/branch length ratio 6 16% – 20% – 18% – 2% –
Claw 3 heights
Branch 6 5.3 – 9.0 29.2 – 40.2 7.2 34.3 1.2 4.0
Spur 6 1.0 – 1.8 5.5 – 7.6 1.4 6.7 0.3 0.9
Spur/branch length ratio 6 18% – 21% – 19% – 1% –
Claw 4 heights
Branch 5 7.2 – 9.0 35.5 – 39.3 8.4 37.2 0.7 1.4
Spur 5 1.4 – 2.1 6.0 – 9.2 1.7 7.5 0.3 1.2
Spur/branch length ratio 5 16% – 23% – 20% – 3% –

DNA sequences

Single haplotypes in 18S rRNA (MT645084, 900 bp), 28S rRNA (MT645082, 754 bp) and ITS-1 (MT645086, 622 bp), but two in COI (MT644270-1, 510 bp) were found.

Phenotypic differential diagnosis

The species was compared with the members of the suillus-facettalis complex (with hemispherical cephalic papillae) and other Pseudechiniscus species lacking pseudosegmental projections. P. shintai sp. nov. is differentiated from:

  1. P. angelusalas Roszkowska et al., 2020, described from Madagascar, by the shape of its cephalic papillae (hemispherical in P. shintai sp. nov. vs. dactyloid, elongated in P. angelusalas) and by the presence of striae (striae absent in P. shintai sp. nov. vs. present, but poorly developed in P. angelusalas);
  2. P. beasleyi Li et al., 2007, described from Qinling Mountains (China), by much shorter claws (5.3–9.2 μm in P. shintai sp. nov. vs. 9.1–13.1 μm in P. beasleyi);
  3. P. chengi Xue et al., 2017, described from Ningxia (China), by body colour (orange in P. shintai sp. nov. vs. brown in P. chengi) and by the distribution of pillars in the dorsal plates (sparsely distributed in P. shintai sp. nov. vs. densely arranged in P. chengi);
  4. P. dastychi Roszkowska et al., 2020, described from the Argentine Islands (maritime Antarctic), by the shape of the cephalic papillae (hemispherical in P. shintai sp. nov. vs. dactyloid, elongated in P. dastychi) and by the presence of striae (striae absent in P. shintai sp. nov. vs. present in P. dastychi);
  5. P. ehrenbergi Roszkowska et al., 2020, described from Northern Italy and reported from Mongolia (Cesari et al. 2020), by the subdivision of the scapular plate (without the median longitudinal suture in P. shintai sp. nov. vs. with the median longitudinal suture in P. ehrenbergi) and by the presence of a rudimentary papilla I (absent in P. shintai sp. nov. vs. present in P. ehrenbergi);
  6. P. indistinctus Roszkowska et al., 2020, described from Norway, by the shape of its cephalic papillae (hemispherical in P. shintai sp. nov. vs. dactyloid, elongated in P. indistinctus) and by the presence of striae (striae absent in P. shintai sp. nov. vs. present in P. indistinctus);
  7. P. lacyformis Roszkowska et al., 2020, described from Norway, by the length of its cephalic appendages: cirrus internus (5.2–8.9 μm in P. shintai sp. nov. vs. 10.6–14.0 μm in P. lacyformis), cirrus externus (6.1–12.8 μm in P. shintai sp. nov. vs. 14.1–19.4 μm in P. lacyformis) and cirrus A (17.1–26.0 μm in P. shintai sp. nov. vs. 26.5–35.0 μm in P. lacyformis);
  8. P. suillus (Ehrenberg, 1853), reliably recorded only from Italy (Grobys et al. 2020), by the length of cirrus A (17.1–26.0 μm in P. shintai sp. nov. vs. 28.4–34.4 μm in P. suillus) and by the presence of males (present in P. shintai sp. nov. vs. absent in P. suillus);
  9. P. xiai Wang et al., 2018, described from Ningxia (China), by the contrasting dorsal sculpturing (epicuticular ornamentation darker and more pronounced in P. xiai) and by the morphology of the pseudosegmental plate IV’ (paired in P. shintai sp. nov. vs. unpaired in P. xiai).

Moreover, the ventral pattern distinguishes P. shintai sp. nov. from all other species for which this character has been described. We used morphometric differences for comparisons only as a last resort as sample sizes for the majority of the specimens in the type series were small. Importantly, although Roszkowska et al. (2020) included P. angelusalas, P. dastychi and P. indistinctus in the suillus-facettalis complex, such combination is phylogenetically unjustified, as they all exhibit elongated (dactyloid) cephalic papillae, which is a distinguishing trait of P. novaezeelandiae (Richters, 1908) (see Pilato et al. 2005) and of the entire novaezeelandiae lineage (Cesari et al. 2020).

Genotypic differential diagnosis

p-distances between the new species and the remaining Pseudechiniscus spp., for which COI sequences are available, ranged between 18.6% (P. suillus) and 29.3% (P. lacyformis). Intraspecific distance was equal to 0.2%.

Discussion

The dorsal sculpturing of P. asper is particularly interesting morphologically, as large, roughly circular endocuticular pillars protrude through the epicuticle as isolated, solid bumps, unconnected by thin ridges – striae. In many other Pseudechiniscus species, striae are typical elements of the armour (e.g. Pilato et al. 2004, Pilato and Lisi 2006). Tumanov (2020) suggested that their presence may represent a phylogenetic signal and, as striae are absent in P. suillus (Grobys et al. 2020), this could mean that the absence of striae is a trait specific to the suillus-facettalis lineage (Cesari et al. 2020). The hypothesis would necessitate a comprehensive analysis of the sculpturing amongst the entire suite of species.

The recent studies on Pseudechiniscus imply that all previous records of putatively cosmopolitan species should be questioned and verified to ensure against misidentification (Grobys et al. 2020, Tumanov 2020). This is the case for almost all Pseudechiniscus spp. reported from Japan: P. suillus, P. bartkei Węglarska, 1962, P. facettalis Petersen, 1951, P. pseudoconifer Ramazzotti, 1943 and P. ramazzottii Maucci, 1952 (see Suzuki 2017). As the Japanese fauna of the four main islands is considered to be a part of the Palaearctic with high levels of endemism in many animal groups due to the isolation during glaciation periods (Motokawa 2017), it cannot be excluded that some of the above-mentioned species inhabit the Japanese archipelago (all but P. bartkei were described from the Western Palaearctic and Greenland). To confirm their status as native to Japan, re-descriptions must be prepared and an enhanced sampling effort is required in Japan.

Acknowledgements

Brian Blagden kindly proofread the manuscript. Diane Nelson, Atsushi Suzuki and Harry Meyer are gratefully acknowledged for the improvements made on the manuscript. The study was performed within the scope of the Preludium grant funded by the National Science Centre (grant no. 2019/33/N/NZ8/02777 to PG supervised by ŁM) and the Sonata Bis programme of the National Science Centre (grant no. 2016/22/E/NZ8/00417 to ŁM). Łukasz Michalczyk is acknowledged for advice and constant support. We owe our sincere thanks to the Museum für Naturkunde, Berlin, for covering the publication charge. The Authors declare no conflict of interest.

References

  • Abe W, Utsugi K, Takeda M (1998) Pseudechiniscus asper, a new Tardigrada (Heterotardigrada: Echiniscidae) from Hokkaido, Northern Japan. Proceedings of the Biological Society of Washington 111: 843–848.
  • Bartels PJ, Apodaca JJ, Mora C, Nelson DR (2016) A global biodiversity estimate of a poorly known taxon: phylum Tardigrada. Zoological Journal of the Linnean Society 178: 730–736. https://doi.org/10.1111/zoj.12441
  • Campbell LI, Rota-Stabelli O, Edgecombe GD, Marchioro T, Longhorn SJ, Telford MJ, Philippe H, Rebecchi L, Peterson KJ, Pisani D (2011) MicroRNAs and phylogenomics resolve the relationships of Tardigrada and suggest that velvet worms are the sister group of Arthropoda. PNAS 108: 15920–15924. https://doi.org/10.1073/pnas.1105499108
  • Casquet J, Thebaud C, Gillespie RG (2012) Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources 12: 136–141. https://doi.org/10.1111/j.1755-0998.2011.03073.x
  • Cesari M, Montanari M, Kristensen RM, Bertolani R, Guidetti R, Rebecchi L (2020) An integrated study of the biodiversity within the Pseudechiniscus suillus–facettalis group (Heterotardigrada: Echiniscidae). Zoological Journal of the Linnean Society 188: 717–732. https://doi.org/10.1093/zoolinnean/zlz045
  • Dabert J, Ehrnsberger R, Dabert M (2008) Glaucalges tytonis sp. nov. (Analgoidea: Xolalgidae) from the barn owl Tyto alba (Strigiformes: Tytonidae): compiling morphology with DNA barcode data for taxa descriptions in mites (Acari). Zootaxa 1719: 41–52.
  • Dastych H (1980) Niesporczaki (Tardigrada) Tatrzańskiego Parku Narodowego. Monografie Fauny Polski 9: 1–232.
  • Dastych H (1999) A new species of the genus Mopsechniscus Du Bois-Reymond Marcus, 1944 (Tardigrada) from the Venezuelan Andes. Acta biologica Benrodis 10: 91–101.
  • Doyère M (1840) Mémoire sur les tardigrades. Annales des Sciences Naturelles, Zoologie (Series 2) 14: 269–362.
  • Ehrenberg CG (1853) Diagnoses novarum formarum. Monatsberichte der Königlich Preussischen Akademie der Wissenschaften zu Berlin 8: 526–533.
  • Fontoura P, Pilato G, Lisi O (2010) First record of Tardigrada from São Tomé (Gulf of Guinea, Western Equatorial Africa) and description of Pseudechiniscus santomensis sp. nov. (Heterotardigrada: Echiniscidae). Zootaxa 2564: 31–42. https://doi.org/10.11646/zootaxa.2564.1.2
  • Gąsiorek P, Blagden B, Michalczyk Ł (2019) Towards a better understanding of echiniscid intraspecific variability: A redescription of Nebularmis reticulatus (Murray, 1905) (Heterotardigrada: Echiniscoidea). Zoologischer Anzeiger 283: 242–255. https://doi.org/10.1016/j.jcz.2019.08.003
  • Gąsiorek P, Stec D, Morek W, Michalczyk Ł (2017) An integrative redescription of Echiniscus testudo (Doyère, 1840), the nominal taxon for the class Heterotardigrada (Ecdysozoa: Panarthropoda: Tardigrada). Zoologischer Anzeiger 270: 107–122. https://doi.org/10.1016/j.jcz.2017.09.006
  • Gąsiorek P, Stec D, Zawierucha K, Kristensen RM, Michalczyk Ł (2018b) Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472: 261–297. https://doi.org/10.11646/zootaxa.4472.2.3
  • Gąsiorek P, Suzuki AC, Kristensen RM, Lachowska-Cierlik D, Michalczyk Ł (2018a) Untangling the Echiniscus Gordian knot: Stellariscus gen. nov. (Heterotardigrada: Echiniscidae) from Far East Asia. Invertebrate Systematics 32: 1234–1247. https://doi.org/10.1071/IS18023
  • Giribet G, Edgecombe GD (2017) Current understanding of Ecdysozoa and its internal phylogenetic relationships. Integrative and Comparative Biology 57: 455–466. https://doi.org/10.1093/icb/icx072
  • Grobys D, Roszkowska M, Gawlak M, Kmita H, Kepel A, Kepel M, Parnikoza I, Bartylak T, Kaczmarek Ł (2020) High diversity in the Pseudechiniscus suillus–facettalis complex (Heterotardigrada: Echiniscidae) with remarks on the morphology of the genus Pseudechiniscus. Zoological Journal of the Linnean Society 188: 733–752. https://doi.org/10.1093/zoolinnean/zlz171
  • Guidetti R, Cesari M, Bertolani R, Altiero T, Rebecchi L (2019) High diversity in species, reproductive modes and distribution within the Paramacrobiotus richtersi complex (Eutardigrada, Macrobiotidae). Zoological Letters 5: 1. https://doi.org/10.1186/s40851-018-0113-z
  • Hall TA (1999) BioEdit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Kawamura Y (2007) Last glacial and Holocene land mammals of the Japanese islands: their fauna, extinction and immigration. Quaternary Research 46: 171–177. https://doi.org/10.4116/jaqua.46.171
  • Kristensen RM (1987) Generic revision of the Echiniscidae (Heterotardigrada), with a discussion of the origin of the family. In: Bertolani R (Ed.) Biology of Tardigrades. Selected Symposia and Monographs U.Z.I. 1: 261–335.
  • Kumar S, Stecher G, Tamura K (2016) MEGA 7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33: 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Li X, Wang L, Yu D (2007) The Tardigrada fauna of China with descriptions of three new species of Echiniscidae. Zoological Studies 46: 135–147.
  • Marcus E (1927) Zur Anatomie und Ökologie mariner Tardigraden. Zoologische Jahrbücher. Abteilung für Systematik 53: 487–558.
  • Maucci W (1952) Un nuovo Pseudechiniscus del Carso Triestino (Tardigrada, Scutechiniscidae). Atti della Società Italiana di Scienze Naturali 91: 127–130.
  • Mironov SV, Dabert J, Dabert M (2012) A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the long-tailed tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253: 54–61. https://doi.org/10.11646/zootaxa.3253.1.2
  • Morek W, Stec D, Gąsiorek P, Surmacz B, Michalczyk Ł (2019) Milnesium tardigradum Doyère, 1840: The first integrative study of interpopulation variability in a tardigrade species. Journal of Zoological Systematics and Evolutionary Research 57: 1–23. https://doi.org/10.1111/jzs.12233
  • Motokawa M (2017) “Land emergence” and “elevation shift” affect diversification: A new perspective toward understanding the high species diversity of terrestrial animals in Japan. In: M. Motokawa, H. Kajihara (Eds) Species Diversity of Animals in Japan. Diversity and Commonality in Animals. Springer, Tokyo. https://doi.org/10.1007/978-4-431-56432-4
  • Møbjerg N, Halberg KA, Jørgensen A, Persson D, Bjørn M, Ramløv H, Kristensen RM (2011) Survival in extreme environments – on the current knowledge of adaptations in tardigrades. Acta Physiologica 202: 409–420. https://doi.org/10.1111/j.1748-1716.2011.02252.x
  • Petersen B (1951) The tardigrade fauna of Greenland. Meddelelser om Grønland 150: 5–94.
  • Pilato G, Binda MG, Lisi O (2005) Remarks on some Echiniscidae (Heterotardigrada) from New Zealand with the description of two new species. Zootaxa 1027: 27–45. https://doi.org/10.11646/zootaxa.1027.1.2
  • Pleijel F, Jondelius U, Norlinder E, Nygren A, Oxelman B, Schander C, Sundberg P, Thollesson M (2008) Phylogenies without roots? A plea for the use of vouchers in molecular studies. Molecular Phylogenetics and Evolution 48: 369–371. https://doi.org/10.1016/j.ympev.2008.03.024
  • Ramazzotti G (1943) Di alcuni tardigradi italiani con descrizione di una nuova specie. Atti della Società Italiana di Scienze Naturali e del Museo Civico di Storia Naturale in Milano 82: 27–35.
  • Richters F (1908) Beitrag zur Kenntnis der Moosfauna Australiens und der Inseln des Pazifischen Ozeans. Zoologische Jahrbücher. Abteilung für Systematik, Ökologie und Geographie der Tiere 26: 196–213.
  • Richters F (1926) Tardigrada. In: Kükenthal W, Krumbach T (Eds) Handbuch der Zoologie. Berlin und Leipzig, Walter de Gruyter & Co., 1–68.
  • Roszkowska M, Grobys D, Bartylak T, Gawlak M, Kmita H, Kepel A, Kepel M, Parnikoza I, Kaczmarek Ł (2020) Integrative description of five Pseudechiniscus species (Heterotardigrada; Echiniscidae; the suillus-facettalis complex). Zootaxa 4763: 451–484. https://doi.org/10.11646/zootaxa.4763.4.1
  • Stec D, Krzywański Ł, Arakawa K, Michalczyk Ł (2020) A new redescription of Richtersius coronifer, supported by transcriptome, provides resources for describing concealed species diversity within the monotypic genus Richtersius (Eutardigrada). Zoological Letters 6: 2. https://doi.org/10.1186/s40851-020-0154-y
  • Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł (2015) An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052: 501–526. https://doi.org/10.11646/zootaxa.4052.5.1
  • Stec D, Zawierucha K, Michalczyk Ł (2017) An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300: 403–420. https://doi.org/10.11646/zootaxa.4300.3.4
  • Suzuki AC (2017) Tardigrade Research in Japan. In: M. Motokawa, H. Kajihara (Eds) Species Diversity of Animals in Japan. Diversity and Commonality in Animals. Springer, Tokyo. https://doi.org/10.1007/978-4-431-56432-4_10
  • Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. https://doi.org/10.1093/nar/22.22.4673
  • Tumanov DV (2020) Analysis of non-morphometric morphological characters used in the taxonomy of the genus Pseudechiniscus (Tardigrada: Echiniscidae). Zoological Journal of the Linnean Society 188: 753–775. https://doi.org/10.1093/zoolinnean/zlz097
  • Wełnicz W, Grohme MA, Kaczmarek Ł, Schill RO, Frohme M (2011) ITS-2 and 18S rRNA data from Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada, Tardigrada). Journal of Zoological Systematics and Evolutionary Research 49 (Supplement 1): 34–39. https://doi.org/10.1111/j.1439-0469.2010.00595.x
  • Węglarska B (1962) Die Tardigraden Vietnams. Acta Societatis Zoologicae Bohemoslovenicae 26: 300–307.
  • Xue J, Li X, Wang L, Xian P, Chen H (2017) Bryochoerus liupanensis sp. nov. and Pseudechiniscus chengi sp. nov. (Tardigrada: Heterotardigrada: Echiniscidae) from China. Zootaxa 4291: 324–334. https://doi.org/10.11646/zootaxa.4291.2.5
  • Zeller C (2010) Untersuchung der Phylogenie von Tardigraden anhand der Genabschnitte 18S rDNA und Cytochrom c Oxidase Untereinheit 1 (COX I). MSc Thesis, Technische Hochschule Wildau, Germany, 105 pp.
login to comment