An overview of the sexual dimorphism in Echiniscus (Heterotardigrada, Echiniscoidea), with the description of Echiniscus masculinus sp. nov. (the virginicus complex) from Borneo

Piotr Gąsiorek; Katarzyna Vončina; Łukasz Michalczyk

doi:10.3897/zse.96.49989

Abstract

Members of the genus Echiniscus C.A.S. Schultze, 1840 are mostly unisexual, with thelytokously reproducing females. Therefore, every newly described dioecious species in the genus is particularly interesting. Here, we describe Echiniscus masculinus sp. nov. from Gunung Kinabalu, the highest peak of Borneo and the entire Southeast Asia. The new species belongs in the predominantly parthenogenetic E. virginicus complex, and its females are confusingly similar to females of the pantropical E. lineatus Pilato et al., 2008, another member of this group. However, genetic evidence and noticeable sexual dimorphism clearly delineate the new species. Males of E. masculinus sp. nov. are unlike females in the body proportions, cuticular sculpturing, and appendage configuration. The new discoveries provide a justification to review the current knowledge about evolution and forms of sexual dimorphism within Echiniscus.

Key Words

bisexual, clavae, dioecious, Echiniscidae, endemic, Gunung Kinabalu, limno-terrestrial life cycle, tropics

Introduction

A swiftly increasing number of tardigrade species is currently at circa 1300 species (Guidetti and Bertolani 2005; Degma and Guidetti 2007; Degma et al. 2009–2019), which have already approached the conservative estimate of Bartels et al. (2016). This number has also exceeded the mean estimate of circa 1150 (upper 95% CI >2100) limno-terrestrial tardigrade species based on a protocol by Mora et al. (2011). Recent works have included DNA barcoding in modern tardigrade taxonomy, disclosing numerous species complexes in various phylogenetic lineages of the phylum (e.g. Stec et al. 2018; Guidetti et al. 2019; Cesari et al. 2020). On the other hand, many tardigrade groups contain a significant number of dubious or synonymic taxa (e.g. Gąsiorek et al. 2019b). Within the class Heterotardigrada, the greatest progress in solving taxonomic and phylogenetic problems has been made regarding a fascinating group of armoured limno-terrestrial tardigrades, the family Echiniscidae (Kristensen 1987; Jørgensen et al. 2011, 2018; Vicente et al. 2013; Vecchi et al. 2016; Gąsiorek et al. 2018a, 2018b, 2019b; Cesari et al. 2020). Recently, Gąsiorek et al. (2019a) demonstrated synonymy within the Echiniscus virginicus complex, reducing the number of valid species from five to four, and for the first time presenting an integrative evidence for a pantropical tardigrade species. Currently, only one member of this group, E. clevelandi (Beasley 1999), is dioecious.

Gunung Kinabalu, together with the Crocker Range located farther south, constitute the highest prominence in the northern part of Borneo. Due to the remarkable geological and climatic conditions, an altitudinal zonation of flora is present on Gunung Kinabalu (Kitayama 1992), which is a characteristic of many high mountain peaks in the Indomalayan region (van Steenis 1984; Ohsawa et al. 1985). Consequently, these mountains harbour unparalleled animal diversity associated with rich plant vegetation, even for the extraordinarily speciose faunae of the Malay Archipelago (Lohman et al. 2011; de Bruyn et al. 2014). On the other hand, as in many tropical areas, some animal groups remain barely known. This is the case with tardigrades, the subject of only two Bornean papers (Pilato et al. 2004; Gąsiorek 2018). Given the recent explosion of hidden species diversity in several tardigrade genera, it is more than likely that Bornean rainforests hold numerous undescribed tardigrade species.

In this contribution, by using morphological and phylogenetic methods, we describe Echiniscus masculinus sp. nov. from a high elevation in Gunung Kinabalu. The new species sheds light on the evolution of the E. virginicus complex and raises questions about the prevalent type of speciation (sympatric vs allopatric) in this group. Finally, the sexual dimorphism within Echiniscus is compared to that of other echiniscids, and the apparent morphological stasis in females of the E. virginicus complex is discussed.

Methods

Sample collection and specimen preparation

A total of 52 animals representing the new species was extracted from a moss sample collected in Northern Borneo by Maciej Barczyk on 29 June 2016 (sample code MY.026). The air-dried sample, stored in a paper envelope, was rehydrated in water for several hours, and the obtained sediment was poured into Petri dishes to search for microfauna under a stereomicroscope with dark field illumination. Individuals isolated from the sample were used for two types of analysis: imaging in light microscopy (morphology and morphometry; 44 specimens) and DNA sequencing + phylogenetics (eight specimens).

Imaging, morphometrics, and terminology

Individuals for light microscopy and morphometry were first air-dried on microscope slides, and then mounted in a small drop of Hoyer’s medium and examined under a Nikon Eclipse 50i phase contrast microscope (PCM) associated with a Nikon Digital Sight DS-L2 digital camera. All figures were assembled in Corel Photo-Paint X6, ver. 16.4.1.1281. For deep structures that could not be fully focused in a single light microscope photograph, a series of 2–12 images was taken every circa 0.1 μm and then assembled into a single deep-focus image. All measurements are given in micrometres (μm) and were performed under PCM. Structures were measured only if they were not damaged and if their orientations were suitable. Body length was measured from the anterior to the posterior end of the body, excluding the hind legs. The sp ratio is the ratio of the length of a given structure to the length of the scapular plate (Dastych 1999). Morphometric data were handled using the Echiniscoidea ver. 1.3 template available from the Tardigrada Register, http://www.tardigrada.net/register (Michalczyk and Kaczmarek 2013). The terminology follows Kristensen (1987) and subsequent changes proposed in Gąsiorek et al. (2019b). For qualitative differential diagnoses, species descriptions and amendments of the four taxa constituting the Echiniscus virginicus group were studied (Riggin 1962; Moon and Kim 1990; Beasley 1999; Abe et al. 2000; Pilato et al. 2008; Kaczmarek and Michalczyk 2010; Gąsiorek et al. 2019a).

Genotyping and phylogenetics

The DNA was extracted from eight individual animals following a Chelex 100 resin (Bio-Rad) extraction method by Casquet et al. (2012) with modifications described in detail in Stec et al. (2015). All specimens were mounted in water on temporary slides and examined under PCM before DNA extraction to ensure correct taxonomic identifications. One hologenophore cuticle (Pleijel et al. 2008) was retrieved from an Eppendorf tube, mounted on a permanent slide, and deposited in the Institute of Zoology and Biomedical Research in Kraków. We sequenced four nuclear and one mitochondrial DNA fragments: the small and the large ribosome subunit 18S rRNA and 28S rRNA (918 bp and 728 bp, respectively), the internal transcribed spacers ITS-1 and ITS-2 (642 and 484 bp, respectively), and the cytochrome oxidase subunit I COI (632 bp). All fragments were amplified and sequenced according to the protocols described in Stec et al. (2015); primers and original references for specific PCR programmes are listed in Table 1. Sequences were aligned using default settings of MAFFT7 (Katoh et al. 2002; Katoh and Toh 2008) under G-INS-i strategy. Uncorrected pairwise distances were calculated using MEGA7 (Kumar et al. 2016) and are included as the Suppl. material 2.

Table 1.

Download as

CSV

XLSX

Primers and references for specific protocols for amplification of the five DNA fragments sequenced in the study.

DNA fragment	Primer name	Primer direction	Primer sequence (5’–3’)	Primer source	PCR programme*
18S rRNA	18S_Tar_Ff1	forward	AGGCGAAACCGCGAATGGCTC	Stec et al. (2017)	Zeller (2010)
18S rRNA	18S_Tar_Rr2	reverse	CTGATCGCCTTCGAACCTCTAACTTTCG	Gąsiorek et al. (2017)	Zeller (2010)
28S rRNA	28S_Eutar_F	forward	ACCCGCTGAACTTAAGCATAT	Gąsiorek et al. (2018a)	Mironov et al. (2012)
28S rRNA	28SR0990	reverse	CCTTGGTCCGTGTTTCAAGAC	Mironov et al. (2012)	Mironov et al. (2012)
ITS-1	ITS1_Echi_F	forward	CCGTCGCTACTACCGATTGG	Gąsiorek et al. (2019a)	Wełnicz et al. (2011)
ITS-1	ITS1_Echi_R	reverse	GTTCAGAAAACCCTGCAATTCACG	Gąsiorek et al. (2019a)
ITS-2	ITS3	forward	GCATCGATGAAGAACGCAGC	White et al. (1990)
ITS-2	ITS4	reverse	TCCTCCGCTTATTGATATGC	White et al. (1990)
COI	bcdF01	forward	CATTTTCHACTAAYCATAARGATATTGG	Dabert et al. (2008)
COI	bcdR04	reverse	TATAAACYTCDGGATGNCCAAAAAA	Dabert et al. (2008)

To ensure that the topologies of the trees reconstructed on the basis of genetic markers were identical, we calculated Bayesian inference (BI) marginal posterior probabilities using MrBayes ver. 3.2 (Ronquist and Huelsenbeck 2003) for each of the three markers (COI, ITS-1, and ITS-2) separately. Random starting trees were used, and the analysis was run for ten million generations, sampling the Markov chain every 1000 generations. An average standard deviation of split frequencies of <0.01 was used as a guide to ensure that the two independent analyses had converged. The program Tracer ver. 1.3 (Rambaut et al. 2014) was then used to ensure that Markov chains had reached stationarity and to determine the correct ‘burn-in’ for the analysis, which was the first 10% of generations. The ESS values were >200, and a consensus tree was obtained after summarizing the resulting topologies and discarding the ‘burn-in’. Trees were rooted on Echiniscus succineus. Clades recovered with a posterior probability (PP) between 0.95 and 1.00 were considered well supported, those with a PP between 0.90 and 0.94 were considered moderately supported, and those with a lower PP were considered unsupported. All final consensus trees were viewed and visualized using FigTree ver. 1.4.3 (available at: https://tree.bio.ed.ac.uk/software/figtree).

Data deposition

Raw morphometric data are placed as the Suppl. material 1 and in the Tardigrada Register under http://www.tardigrada.net/register/0062.htm. Type DNA sequences are deposited in GenBank.

Results

Taxonomic account

Phylum Tardigrada Doyère, 1840

Class Heterotardigrada Marcus, 1927

Order Echiniscoidea Richters, 1926

Family Echiniscidae Thulin, 1928

Genus Echiniscus C.A.S. Schultze, 1840

Echiniscus masculinus sp. nov.

http://zoobank.org/99CA96E7-D111-4E07-A0A2-4133F54755C9

Figures 1, 2, 3, Tables 2, 3, 4, 5

Description

Mature females (i.e. from the third instar onwards; measurements and statistics in Table 2). Body cylindrical, orange with minute red eyes present in live specimens; colours disappearing soon after mounting in Hoyer’s medium. Echiniscus-type cephalic papillae (secondary clavae) and (primary) clavae; cirri growing out from bulbous cirrophores (Figure 1A). The body appendage configuration is A-C-D-D^d-E, with all trunk appendages formed as spines or spicules. All usual trunk appendages always symmetrical and smooth. Spine C^d rudimentarily developed in two females (one with an asymmetrical spicule [2 µm], the other normally formed [8 µm]).

Table 2.

Download as

CSV

XLSX

Measurements [in µm] of selected morphological structures of the adult females of Echiniscus masculinus sp. nov. mounted in Hoyer’s medium. N – number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD – standard deviation; sp – the proportion between the length of a given structure and the length of the scapular plate.

Character	N	Range		Mean		SD		Holotype
Character	N	µm	sp	µm	sp	µm	sp	µm	sp
Body length	10	159–192	432–492	175	453	11	21	178	444
Scapular plate length	10	32.6–43.7	–	38.8	–	3.2	–	40.1	–
Head appendages lengths
Cirrus internus	9	9.7–15.5	25.1–38.8	12.6	32.4	2.3	4.9	14.6	36.4
Cephalic papilla	10	5.9–7.8	15.1–19.2	6.7	17.3	0.5	1.3	6.4	16.0
Cirrus externus	8	12.3–18.8	37.7–47.0	16.6	42.7	1.9	3.7	18.8	46.9
Clava	10	4.7–6.4	11.4–17.1	5.5	14.2	0.6	1.6	5.6	14.0
Cirrus A	10	23.3–42.3	69.6–105.5	32.8	84.7	4.7	10.7	33.1	82.5
Cirrus A/Body length ratio	10	15%–24%	–	19%	–	3%	–	19%	–
Body appendages lengths
Spine C	10	10.9–21.6	33.4–56.3	16.6	43.0	3.1	8.3	15.1	37.7
Spine D	10	11.2–21.6	29.5–57.9	16.0	41.3	3.1	8.3	13.8	34.4
Spine D^d	10	2.9–16.8	8.9–45.0	11.7	30.1	4.1	10.9	9.7	24.2
Spine E	10	13.6–23.3	33.9–60.7	18.6	48.3	2.5	8.2	13.6	33.9
Spine on leg I length	10	3.0–3.9	8.0–11.0	3.4	8.8	0.3	0.9	3.3	8.2
Papilla on leg IV length	10	3.6–5.3	9.9–12.9	4.4	11.3	0.6	1.1	4.6	11.5
Number of teeth on the collar	9	8–12	–	10.1	–	1.3	–	9	–
Claw I heights
Branch	8	8.8–10.7	23.5–27.6	9.7	25.3	0.6	1.7	9.7	24.2
Spur	8	2.2–3.2	6.7–8.5	2.8	7.3	0.3	0.6	2.7	6.7
Spur/branch height ratio	8	24%–33%	–	29%	–	2%	–	28%	–
Claw II heights
Branch	9	8.4–10.4	21.5–25.9	9.4	24.4	0.6	1.4	10.0	24.9
Spur	9	2.1–3.1	6.4–8.2	2.8	7.1	0.3	0.5	2.6	6.5
Spur/branch height ratio	9	25%–33%	–	29%	–	3%	–	26%	–
Claw III heights
Branch	10	8.4–10.2	22.7–26.2	9.5	24.5	0.6	1.2	9.9	24.7
Spur	10	2.0–3.1	6.1–7.2	2.6	6.6	0.3	0.4	2.9	7.2
Spur/branch height ratio	10	24%–31%	–	27%	–	2%	–	29%	–
Claw IV heights
Branch	7	9.4–12.1	24.9–30.3	10.9	27.4	0.9	2.4	?	?
Spur	7	2.3–3.2	6.1–8.6	3.0	7.4	0.3	0.9	?	?
Spur/branch height ratio	7	24%–29%	–	27%	–	1%	–	?	–

Figure 1.

Morphology of Echiniscus masculinus sp. nov. (PCM). A. Adult female (holotype, dorsolateral view); B. Juvenile (paratype, dorsolateral view); C. Subcephalic plates; D. Genital plates enclosing male gonopore; E. First leg pair with claws and spine I. All scale bars in µm.

Dorsal plates with the mixed type of sculpturing, with an evident layer of endocuticular pillars visible as black dots under PCM, and an upper layer of greyish epicuticular matrix forming the ornamented pattern together with pseudopores, enhanced as dark belts on the anterior portions of the paired segmental plates (Fig. 1A). Generally, the epicuticular sculpture is poorly developed and gives way to large pillars, especially on the cephalic and scapular plates, and also on the central portion of the median plate I and centroposterior portions of segmental plates. The cephalic plate is relatively large whereas the cervical (neck) plate is barely demarcated from the scapular plate, formed only as thin grey belt without pillars. The scapular plate large, with additional lateral sutures separating narrow rectangular lateral portions with poorly developed pillars. Paired segmental plates divided into a smaller, much narrower anterior and a dominant posterior part by a smooth, wide transverse stripe (Fig. 1A). The caudal (terminal) plate with short incisions and fully developed epicuticular layer. Median plate I unipartite, whereas median plate II divided into weakly defined parts, with a wide rhomboidal smooth space between them (Fig. 1A). Median plate III small but with a well-developed epicuticular layer. Ventral cuticle with minute endocuticular pillars distributed throughout the whole venter, and a pair of oval subcephalic (Fig. 1C) and trapezoid genital plates. Sexpartite gonopore placed between genital plates, and a trilobed anus between legs IV.

Pedal plates I–III absent, pedal plate IV developed as a dark matrix without pillars, bearing a typical dentate collar (Figure 1A). Distinct pulvini on all legs (Fig. 1A). A small spine on leg I (Fig. 1E) and a papilla on leg IV present. Claws IV slightly higher than claws I–III (Table 2). External claws on all legs smooth (Figure 1E). Internal claws with large spurs positioned at circa 1/3 of the claw height and bent downwards.

Buccal apparatus short, with a rigid, stout tube and a spherical pharynx. Stylet supports absent.

Mature males and sexually dimorphic traits (i.e. from the third instar onwards; measurements and statistics in Tables 3, 4). Generally resembling females, but a closer observation reveals two qualitative differences (body appendage configuration and dorsal plate sculpturing) and numerous morphometric dissimilarities between males and females (all summarised in Table 4). Densely punctuated areas in the central leg portions present (Fig. 2A). Male genital plates are always clearly visible (of identical shape as female plates), and dark densely arranged pillars are present in the entire genital zone, extending between the plates (Fig. 1D).

Table 3.

Download as

CSV

XLSX

Measurements [in µm] of selected morphological structures of the adult males of Echiniscus masculinus sp. nov. mounted in Hoyer’s medium. N – number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD – standard deviation; sp – the proportion between the length of a given structure and the length of the scapular plate.

Character	N	Range		Mean		SD		Allotype
Character	N	µm	sp	µm	sp	µm	sp	µm	sp
Body length	10	142–170	464–527	161	493	9	23	167	527
Scapular plate length	10	30.3–35.7	–	32.6	–	1.5	–	31.7	–
Head appendages lengths
Cirrus internus	10	10.2–19.2	31.0–58.9	15.3	47.2	2.3	7.7	15.0	47.3
Cephalic papilla	10	7.7–9.3	23.4–30.0	8.6	26.6	0.6	2.2	8.6	27.1
Cirrus externus	10	16.0–21.0	47.3–67.3	18.8	57.8	1.6	6.0	17.5	55.2
Clava	10	6.1–7.5	19.2–22.8	6.8	20.8	0.4	1.1	6.1	19.2
Cirrus A	8	28.4–36.2	84.6–111.0	31.9	98.0	2.8	9.1	30.0	94.6
Cirrus A/Body length ratio	8	18%–24%	–	20%	–	2%	–	18%	–
Body appendages lengths
Spine C	10	19.9–26.9	63.7–77.9	23.1	70.9	2.3	5.5	24.7	77.9
Spine D	10	17.6–29.7	54.0–83.2	23.0	70.4	3.4	8.5	25.0	78.9
Spine E	10	19.4–30.5	59.1–92.7	24.5	75.1	4.1	12.0	27.7	87.4
Spine on leg I length	10	2.0–3.7	6.5–11.3	3.1	9.6	0.5	1.4	2.8	8.8
Papilla on leg IV length	10	3.8–5.3	12.4–16.2	4.6	14.2	0.5	1.1	4.1	12.9
Number of teeth on the collar	9	7–12	–	9.4	–	1.7	–	12	–
Claw I heights
Branch	10	8.4–10.7	26.5–33.0	9.4	28.9	0.7	2.1	8.4	26.5
Spur	10	2.2–3.1	6.9–9.9	2.7	8.3	0.3	0.8	2.2	6.9
Spur/branch height ratio	10	23%–32%	–	29%	–	3%	–	26%	–
Claw II heights
Branch	9	8.4–10.4	24.9–32.1	9.2	28.4	0.6	2.5	8.6	27.1
Spur	9	1.9–2.7	5.8–8.9	2.4	7.5	0.3	1.0	2.6	8.2
Spur/branch height ratio	9	20%–31%	–	26%	–	3%	–	30%	–
Claw III heights
Branch	8	8.5–10.1	25.8–31.4	9.2	28.3	0.6	2.0	8.7	27.4
Spur	8	2.3–2.8	7.0–8.5	2.5	7.7	0.2	0.5	2.3	7.3
Spur/branch height ratio	8	24%–30%	–	27%	–	2%	–	26%	–
Claw IV heights
Branch	4	9.5–10.4	28.1–34.0	10.1	31.1	0.4	3.2	?	?
Spur	4	2.7–3.1	8.3–9.2	2.9	8.8	0.2	0.4	?	?
Spur/branch height ratio	4	26%–30%	–	28%	–	2%	–	?	–

Table 4.

Download as

CSV

XLSX

Sexual dimorphism in qualitative and quantitative traits in Echiniscus masculinus sp. nov., with results of one-tailed Student’s t-tests in case of overlapping ranges in morphometric traits (all statistically significant at the α-level of p_BH < 0.05 adjusted with the Benjamini-Hochberg correction).

Qualitative traits	♀♀	♂♂	Remarks
Body appendage configuration	A-C-D-D^d-E	A-C-D-E	a single male had an asymmetrically developed spine D^d [8 µm long]
Cuticular sculpturing	epicuticular ornamentation poor	epicuticular ornamentation pronounced	compare Figures 1, 2A, B and 3A, but see also Figures 2C and 3B for an atypically poor sculpturing in a male
Quantitative traits	♀♀: x̄ ± SD, N = 10	♂♂: x̄ ± SD, N = 10	t, p
Body proportions: bs ratio	0.54–0.57 (= body larger and plump)	0.48–0.49 (= body smaller and slender)	non-overlapping ranges; see also Fig. 2
Body length	175 ± 11	161 ± 9	t ₁₈ = 3.27; p = 0.002
Scapular plate length	38.8 ± 3.2	32.6 ± 1.5	t ₁₈ = 5.51; p < 0.001
Head appendages lengths
Cephalic papilla	17.3 ± 1.3	26.6 ± 2.2	t ₁₈ = -11.47; p < 0.001
Clava	14.2 ± 1.6	20.8 ± 1.1	t ₁₈ = -10.44; p < 0.001
Body appendage lengths
Spine C	43.0 ± 8.3	70.9 ± 5.5	t ₁₈ = -8.90; p < 0.001
Spine D	41.3 ± 8.3	70.4 ± 8.5	t ₁₈ = -7.75; p < 0.001
Spine E	48.3 ± 8.2	75.1 ± 12.0	t ₁₈ = -5.79; p < 0.001
Claw branch heights
Claw I	25.3 ± 1.7	28.9 ± 2.1	t ₁₆ = -3.99; p < 0.001
Claw II	24.4 ± 1.4	28.4 ± 2.5	t ₁₆ = -4.36; p < 0.001
Claw III	24.5 ± 1.2	28.3 ± 2.0	t ₁₆ = -5.01; p < 0.001

Figure 2.

Morphology of males of E. masculinus sp. nov. (PCM). A. allotype (dorsolateral view, arrowheads indicate areas with densely packed pillars in legs); B. paratype with fully developed sculpturing (dorsal view); C. paratype with poorly developed epicuticular layer of sculpturing (dorsal view). See Table 4 for the phenotypic comparison between females and males. All scale bars in µm.

Figure 3.

Close-up on the details of sculpturing of E. masculinus sp. nov. (PCM). A. evident epicuticular layer, endocuticular pillars of various sizes; B. remnants of epicuticular layer on the scapular and caudal (terminal) plates, endocuticular pillars densely packed and of equal, minute size. All scale bars in µm.

Juveniles (i.e. the second instar, measurements and statistics in Table 5). Clearly smaller than adult females and males, with the body appendage configuration A-C-D-D^d-E. Endocuticular pillars well developed in all plates, the largest pillars present in the posterior portion of the scapular plate and in the central part of the caudal (terminal) plate. Epicuticular ornamented pattern absent, although lighter and darker parts of the scapular plate can be distinguished under PCM (Fig. 1B), constituting presumably the developing epicuticular layer.

Table 5.

Download as

CSV

XLSX

Measurements [in µm] of selected morphological structures of the juveniles of Echiniscus masculinus sp. nov. mounted in Hoyer’s medium. N – number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD – standard deviation; sp – the proportion between the length of a given structure and the length of the scapular plate.

Character	N	Range		Mean		SD
Character	N	µm	sp	µm	sp	µm	sp
Body length	5	115–148	431–477	129	454	13	18
Scapular plate length	5	26.0–34.4	–	28.4	–	3.6	–
Head appendages lengths
Cirrus internus	5	7.4–12.3	27.1–35.8	8.8	30.7	2.0	3.5
Cephalic papilla	5	3.8–6.4	13.1–19.6	4.9	17.3	1.0	2.7
Cirrus externus	4	8.8–14.2	33.3–41.3	10.8	38.0	2.3	3.4
Clava	5	3.7–5.4	13.7–16.7	4.3	15.2	0.7	1.2
Cirrus A	5	19.5–28.6	74.1–83.5	22.8	80.1	3.5	3.7
Cirrus A/Body length ratio	5	16%–19%	–	18%	–	1%	–
Body appendages lengths
Spine C	5	8.1–20.3	30.8–59.0	12.9	44.6	4.6	10.7
Spine D	5	7.4–17.5	28.5–50.9	11.6	39.9	4.1	9.3
Spine D^d	5	7.1–16.1	27.0–46.8	10.4	35.9	3.4	7.3
Spine E	5	10.8–18.0	40.2–52.3	12.7	44.3	3.0	4.9
Spine on leg I length	4	1.9–2.7	7.2–9.1	2.2	7.9	0.4	0.9
Papilla on leg IV length	5	3.2–3.8	10.8–14.4	3.4	12.2	0.3	1.5
Number of teeth on the collar	5	7–8	–	7.6	–	0.5	–
Claw I heights
Branch	5	6.3–9.3	24.0–27.0	7.3	25.6	1.2	1.2
Spur	5	1.5–2.7	5.2–8.1	1.9	6.8	0.5	1.2
Spur/branch height ratio	5	21%–31%	–	27%	–	4%	–
Claw II heights
Branch	4	6.1–6.8	23.2–25.0	6.5	24.0	0.3	0.9
Spur	4	1.4–1.9	5.4–7.2	1.7	6.2	0.2	0.8
Spur/branch height ratio	4	22%–31%	–	26%	–	4%	–
Claw III heights
Branch	4	6.3–8.9	23.0–25.9	7.1	24.3	1.2	1.2
Spur	4	1.7–2.5	5.8–7.3	2.0	6.7	0.4	0.6
Spur/branch height ratio	4	25%–29%	–	28%	–	1%	–
Claw IV heights
Branch	4	6.7–9.1	25.4–27.7	7.6	26.3	1.0	1.0
Spur	4	1.8–2.8	6.8–8.5	2.2	7.7	0.4	0.8
Spur/branch height ratio	4	25%–33%	–	29%	–	4%	–

Larvae. Unknown.

Eggs. Up to two round, yellow eggs per exuvia were found.

Genetic markers and phylogenetic position. The 18S rRNA, 28S rRNA and ITS-2 were characterised by single haplotypes (GenBank accession numbers: MT106621, MT106620, MT106622, respectively), but three haplotypes were detected in the case of ITS-1 (MT106623–5), and five in COI (MT106223–7). All three DNA-based phylogenetic reconstructions revealed E. masculinus sp. nov. as the sister species to the clade E. lineatus + E. virginicus with a maximum support (Fig. 4). The divergence between the new species and the other two congeners was notably larger in COI compared to the ITS markers (compare Fig. 4A and 4B, C). The differences are congruent with the p-distances (see SM.2).

Figure 4.

Bayesian phylogenetic trees showing the relationships between members of the E. virginicus complex; E. succineus was used as an outgroup, and branches within species-specific clades were collapsed. Bayesian posterior probability values are given above tree branches. Phylogenetic analyses were run on the subsequent DNA markers to assure that the tree topology was congruent: COI, ITS-1, and ITS-2.

Type material

Holotype (mature female, slide MY.026.05), allotype (mature male, slide MY.026.07) and 42 paratypes on slides MY.026.01–09. Moreover, one voucher specimen (hologenophore) mounted on the slide MY.026.14. In total: 21 females, 14 males, and nine juveniles. Slides MY.026.01–07 are deposited in the Institute of Zoology and Biomedical Research, Jagiellonian University, Poland; slide MY.026.08 (4♀♀, 3♂♂, one juvenile) is deposited in the Natural History Museum of Denmark, University of Copenhagen, Denmark; slide MY.026.09 (4♀♀, 2♂♂, 2 juveniles) is deposited in the Catania University, Sicily, Italy. Found together with a new species of Echiniscus and a new species of Pseudechiniscus (descriptions in preparation).

Type locality

Ca 6°05'N, 116°32'E, ca 3500 m a.s.l.: Malaysia, Borneo, Sabah, Gunung Kinabalu; subalpine vegetation zone with single Leptospermum and Rhododendron ericoides bushes, moss on a stunted tree trunk.

Etymology

From Latin masculinus = male (an adjective in the nominative singular). The name underlines the presence of males in the new species, in contrast to closely related parthenogenetic E. lineatus and E. virginicus.

Differential diagnosis

There are four known members of the E. virginicus complex: E. clevelandi Beasley, 1999, E. hoonsooi Moon & Kim, 1990, E. lineatus Pilato et al., 2008, and E. virginicus Riggin, 1962 (Gąsiorek et al. 2019a). Echiniscus masculinus sp. nov. can be differentiated from (body appendage configuration given collectively for both sexes):

E. clevelandi , recorded from China, the only other dioecious representative of this group, by the body appendage configuration (A-C-D- (D ^d) -E in E. masculinus sp. nov. vs A-B-C-C ^d-D-D ^d-E in E. clevelandi) and dorsal sculpturing (faint and poorly visible epicuticular layer with pseudopores in E. masculinus sp. nov. vs well-developed epicuticular layer with bright and large pores in E. clevelandi; see Pilato et al. 2008).
E. hoonsooi , recorded from Korea, by the body appendage configuration (A-C-D- (D ^d) -E in E. masculinus sp. nov. vs A- (C) - (D) -E in E. hoonsooi), homomorphic spurs on all legs (heteromorphic spurs I–III and IV in E. hoonsooi; see Abe et al. 2000), and by the presence of males.
E. lineatus , distributed widely in the tropical and subtropical zone, by the body appendage configuration (A-C-D- (D ^d) -E in E. masculinus sp. nov. vs A- (B) -C-C ^d-D-D ^d-E in E. lineatus), and by the presence of males.
E. virginicus , native to the eastern Nearctic realm, by the body appendage configuration (A-C-D- (D ^d) -E in E. masculinus sp. nov. vs A- (B) -C-C ^d-D-D ^d-E in E. virginicus), dorsal plate sculpturing (pseudopores in E. masculinus sp. nov. vs pores in E. virginicus), and by the presence of males.

Discussion

The Echiniscus virginicus complex contains species with well-defined geographical ranges: E. lineatus is pantropical, E. clevelandi and E. hoonsooi are known from Far East Asia, and E. virginicus has been recorded only from the Nearctic (Gąsiorek et al. 2019a). Phylogenetic analyses inferred the new species as sister to the clade E. lineatus + E. virginicus, with the latter two more closely related to each other than to E. masculinus sp. nov. (Fig. 4). This is surprising for two reasons: the same place of origin of E. masculinus sp. nov. and E. lineatus, the tropics, as both occur only there, and the morphological similarity of these two species, since they both have pseudopores. As it is generally assumed that dioecy is ancestral, and parthenogenetic thelytoky is an advanced character within Echiniscidae (e.g. Kristensen 1987), the presence of males within populations of E. masculinus sp. nov. is probably a retained plesiomorphy of the entire complex. Given that the new species is described from a very peculiar habitat, namely a prominent mountain peak with high levels of endemism characterising many groups of animals (Merckx et al. 2015), the isolated locality suggests a contracted, relictual geographic range of E. masculinus sp. nov. and its potentially restricted area of occurrence (only Gunung Kinabalu or maybe also other high mountains of Borneo).

In contrast to arthrotardigrades, usually ancestrally dioecious (Fontoura et al. 2017), echiniscoidean taxa are more diversified in terms of reproductive modes and many groups embrace both parthenogenetic and dioecious species. Echiniscoididae and Oreellidae are bisexual (Kristensen and Hallas 1980; Dastych et al. 1998; Møbjerg et al. 2016), but sexual dimorphism is not well-marked in either of the two. The first observations on sexual dimorphism within Echiniscidae were documented by Dastych (1987) and Kristensen (1987). At present, males have been reported for 14 echiniscid genera: Antechiniscus (Claxton 2001), Barbaria (Miller et al. 1999; Michalczyk and Kaczmarek 2007), Bryodelphax (Gąsiorek and Degma 2018), Claxtonia (Kaczmarek and Michalczyk 2002; Mitchell and Romano 2007), Cornechiniscus (Dastych 1979), Diploechiniscus (Vicente et al. 2013), Hypechiniscus (Kristensen 1987), Mopsechiniscus (Dastych 2001), Novechiniscus (Rebecchi et al. 2008), Proechiniscus (Kristensen 1987), Pseudechiniscus (Cesari et al. 2020), Stellariscus (Gąsiorek et al. 2018b), Testechiniscus (Gąsiorek et al. 2018a), and Echiniscus. Sexual dimorphism can be obvious, as in Mopsechiniscus, or restricted to different gonopore shapes (e.g. in Cornechiniscus). Until now, males have been reliably discovered only in 11 Echiniscus spp. (Degma et al. 2009–2019): E. clevelandi (the virginicus complex), E. curiosus Claxton, 1996 and E. merokensis Richters, 1904 (the merokensis complex), E. duboisi Richters, 1902 and E. siticulosus Gąsiorek & Michalczyk, 2020 (the spinulosus complex), E. ehrenbergi Dastych & Kristensen, 1995 and E. rodnae Claxton, 1996 (the testudo complex), E. jamesi Claxton, 1996 (the granulatus complex), E. lentiferus Claxton & Dastych, 2017 (the quadrispinosus complex), E. marleyi Li, 2007 (the blumi–canadensis complex), E. nepalensis Dastych, 1975 (the lapponicus complex). The differences between the sexes are often minor (Dastych 1975; Dastych and Kristensen 1995; Miller et al. 1999), but some authors emphasised notable disparities in morphometric traits (Beasley 1999; Claxton 1996; Claxton and Dastych 2017; Gąsiorek and Michalczyk 2020). These encompass mainly differences in body proportions, and dimensions of claws, cephalic and trunk appendages (Claxton 1996; Gąsiorek and Michalczyk 2020). The sex ratio varies greatly even between populations of a single species (Miller et al. 1999), indicating that there may be seasonal variations in the presence of males within Echiniscus populations, as was observed for other micrometazoans (Gilbert and Williamson 1983).

Originally, the “Gondwanan” hypothesis was postulated to explain the distribution of dioecious Echiniscus spp. (Miller et al. 1999). In fact, except for the cosmopolitan E. merokensis and East Palaearctic E. marleyi, other dioecious Echiniscus spp. inhabit exclusively post-Gondwanan lands. Additionally, males are generally absent or present in almost negligible proportions in European and Central Asian populations of Echiniscus (Jørgensen et al. 2007; Guil and Giribet 2009). The evolutionary causes of this phenomenon are, however, still unknown.

The sexual dimorphism of E. masculinus sp. nov., evidenced in both quantitative and qualitative traits (Table 4) is interesting in the context of usually poorly marked sexual differences in dioecious Echiniscus spp., and the fact that females of E. lineatus, E. virginicus, and E. masculinus sp. nov. are confusingly similar to each other. In fact, females are a good example of profound evolutionary stasis in morphology, which led, for example, to a description of a synonymous species in the complex (E. dariae synonymised with E. lineatus by Gąsiorek et al. 2019a). In contrast, males of E. masculinus sp. nov. and E. clevelandi can be easily distinguished based on the differences in dorsal sculpturing and appendage configuration (compare Beasley 1999 and the present study). Consequently, a question arises: why do females of the virginicus complex tend to diverge morphologically at a slower rate than males? The acquisition of genetic data for E. clevelandi and E. hoonsooi could help to resolve this conundrum, as the putative, basal, character of E. clevelandi and E. masculinus sp. nov. within the virginicus clade would support the hypothesis that asexually reproducing species are young and poorly phenotypically differentiated from each other and from the ancestral female phenotype. Finally, considering that the sexually reproducing E. masculinus sp. nov. is a sister taxon to the asexual E. lineatus + E. virginicus clade, we hypothesise that the males were originally present in the ancestor of the clade. Moreover, given the overall similarity of males of E. clevelandi and E. masculinus sp. nov., we also hypothesise that males in the ancestral lineage leading to E. lineatus and E. virginicus were phenotypically similar to males of E. masculinus sp. nov.

Conclusions

The description of sexually dimorphic E. masculinus sp. nov. elucidates the evolution of the virginicus complex and raises new questions about the phenotype evolution in tardigrades. Females of three species (E. lineatus, E. virginicus and E. masculinus sp. nov.) represent an exemplary case of delusively similar taxa (i.e. almost identical under PCM but easily identifiable with SEM analysis). The tardigrade fauna of the Indomalayan region requires more sampling effort to uncover its diversity and uniqueness.

Acknowledgements

We are most grateful to Maciej Barczyk (Senckenberg Biodiversity and Climate Research Centre, Goethe University Frankfurt, Germany) for the collection of the sample. We would also like to thank Diane Nelson, Reinhardt M. Kristensen, and an anonymous reviewer, who contributed to the improvement of this manuscript. The study was supported by the Polish Ministry of Science and Higher Education via the Diamond Grant (DI2015 014945 to PG, supervised by ŁM) and by the Sonata Bis programme of the Polish National Science Centre (grant no. 2016/22/E/NZ8/00417 to ŁM). We owe our sincere thanks to the Museum für Naturkunde, Berlin, for covering the publication charge.

References

Abe W, Ito M, Takeda M (2000) First record of Echiniscus hoonsooi (Tardigrada: Echiniscidae) from Japan. Species Diversity 5: 103–110. https://doi.org/10.12782/specdiv.5.103

Bartels PJ, Apodaca JJ, Mora C, Nelson DR (2016) A global biodiversity estimate of a poorly known taxon: phylum Tardigrada. Zoological Journal of the Linnean Society 178: 730–736. https://doi.org/10.1111/zoj.12441

Beasley CW (1999) A new species of Echiniscus (Tardigrada, Echiniscidae) from Northern Yunnan Province, China. Zoologischer Anzeiger 238: 135–138.

Casquet J, Thebaud C, Gillespie RG (2012) Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources 12: 136–141. https://doi.org/10.1111/j.1755-0998.2011.03073.x

Cesari M, Montanari M, Kristensen RM, Bertolani R, Guidetti R, Rebecchi L (2020) An integrated study of the biodiversity within the Pseudechiniscus suillus–facettalis group (Heterotardigrada: Echiniscidae). Zoological Journal of the Linnean Society 188: 717–732. https://doi.org/10.1093/zoolinnean/zlz045

Claxton SK (1996) Sexual dimorphism in Australian Echiniscus (Tardigrada, Echiniscidae) with descriptions of three new species. Zoological Journal of the Linnean Society 116: 13–33. https://doi.org/10.1111/j.1096-3642.1996.tb02330.x

Claxton SK (2001) Antechiniscus in Australia: Description of Antechiniscus moscali sp. n. and redescription of Antechiniscus parvisentus (Horning & Schuster, 1983) (Heterotardigrada: Echiniscidae). Zoologischer Anzeiger 240: 281–289. https://doi.org/10.1078/0044-5231-00035

Claxton SK, Dastych H (2017) A new bisexual species of Echiniscus C.A.S. Schultze, 1840 (Heterotardigrada: Echiniscidae) from Tasmania, Australia. Entomologie Heute 29: 105–119.

Dastych H (1975) Some Tardigrada from the Himalayas (Nepal) with a description of Echiniscus (E.) nepalensis n. sp. Memorie dell’Istituto Italiano di Idrobiologia 32 (Supplement): 61–68.

Dastych H (1979) Tardigrada from Afghanistan with a description of Pseudechiniscus schrammi sp. nov. Bulletin de la Société des Amis des Sciences et des Lettres de Poznań, Série D, sciences biologiques 19: 99–108.

Dastych H (1987) Two new species of Tardigrada from the Canadian Subarctic with some notes on sexual dimorphism in the family Echiniscidae. Entomologische Mitteilungen aus dem Zoologischen Museum Hamburg 8: 319–334.

Dastych H (2001) Notes on the revision of the genus Mopsechiniscus (Tardigrada). Zoologischer Anzeiger 240: 299–308. https://doi.org/10.1078/0044-5231-00037

Dastych H, Kristensen RM (1995) Echiniscus ehrenbergi sp. n., a new water bear from the Himalayas (Tardigrada). Entomologische Mitteilungen aus dem Zoologischen Museum Hamburg 11: 221–230.

Dastych H, McInnes SJ, Claxton SK (1998) Oreella mollis Murray, 1910 (Tardigrada): a redescription and revision of Oreella. Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut 95: 89–113.

de Bruyn M, Stelbrink B, Morley RJ, Hall R, Carvalho GR, Cannon CH, van den Bergh G, Meijaard E, Metcalfe I, Boitani L, Maiorano L, Shoup R, von Rintelen T (2014) Borneo and Indochina are major evolutionary hotspots for Southeast Asian biodiversity. Systematic Biology 63: 879–901. https://doi.org/10.1093/sysbio/syu047

Degma P, Bertolani R, Guidetti R (2009–2019) Actual checklist of Tardigrada species. Ver. 36: 01-09-2019. https://doi.org/10.25431/11380_1178608

Degma P, Guidetti R (2007) Notes to the current checklist of Tardigrada. Zootaxa 1579: 41–53. https://doi.org/10.11646/zootaxa.1579.1.2

Fontoura P, Bartels PJ, Jøgensen A, Kristensen RM, Hansen JG (2017) A dichotomous key to the genera of the marine heterotardigrades (Tardigrada). Zootaxa 4294: 1–45. https://doi.org/10.11646/zootaxa.4294.1.1

Gąsiorek P (2018) New Bryodelphax species (Heterotardigrada: Echiniscidae) from Western Borneo (Sarawak), with new molecular data for the genus. Raffles Bulletin of Zoology 66: 371–381.

Gąsiorek P, Degma P (2018) Three Echiniscidae species (Tardigrada: Heterotardigrada) new to the Polish fauna, with the description of a new gonochoristic Bryodelphax Thulin, 1928. Zootaxa 4410: 77–96. https://doi.org/10.11646/zootaxa.4410.1.4

Gąsiorek P, Jackson KJ, Meyer HA, Zając K, Nelson DR, Kristensen RM, Michalczyk Ł (2019a) Echiniscus virginicus complex: the first case of pseudocryptic allopatry and pantropical distribution in tardigrades. Biological Journal of the Linnean Society 128: 789–805. https://doi.org/10.1093/biolinnean/blz147

Gąsiorek P, Michalczyk Ł (2020) Echiniscus siticulosus (Echiniscidae: spinulosus group), a new tardigrade from Western Australian scrub. New Zealand Journal of Zoology 47: 87–105. https://doi.org/10.1080/03014223.2019.1603166

Gąsiorek P, Morek W, Stec D, Michalczyk Ł (2019b) Untangling the Echiniscus Gordian knot: paraphyly of the “arctomys group” (Heterotardigrada: Echiniscidae). Cladistics 35: 633–653. https://doi.org/10.1111/cla.12377

Gąsiorek P, Stec D, Zawierucha K, Kristensen RM, Michalczyk Ł (2018a) Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472: 261–297. https://doi.org/10.11646/zootaxa.4472.2.3

Gąsiorek P, Suzuki AC, Kristensen RM, Lachowska-Cierlik D, Michalczyk Ł (2018b) Untangling the Echiniscus Gordian knot: Stellariscus gen. nov. (Heterotardigrada: Echiniscidae) from Far East Asia. Invertebrate Systematics 32: 1234–1247. https://doi.org/10.1071/IS18023

Gilbert JJ, Williamson CE (1983) Sexual dimorphism in zooplankton (Copepoda, Cladocera, and Rotifera). Annual Review of Ecology and Systematics 14: 1–33. https://doi.org/10.1146/annurev.es.14.110183.000245

Guidetti R, Cesari M, Bertolani R, Altiero T, Rebecchi L (2019) High diversity in species, reproductive modes and distribution within the Paramacrobiotus richtersi complex (Eutardigrada, Macrobiotidae). Zoological Letters 5: 1. https://doi.org/10.1186/s40851-018-0113-z

Guidetti R, Bertolani R (2005) Tardigrade taxonomy: an updated check list of the taxa and a list of characters for their identification Zootaxa 845: 1–46. https://doi.org/10.11646/zootaxa.845.1.1

Guil N, Giribet G (2009) Fine scale population structure in the Echiniscus blumi–canadensis series (Heterotardigrada, Tardigrada) in an Iberian mountain range – When morphology fails to explain genetic structure. Molecular Phylogenetics and Evolution 51: 606–613. https://doi.org/10.1016/j.ympev.2009.02.019

Jørgensen A, Kristensen RM, Møbjerg N (2018) Phylogeny and integrative taxonomy of Tardigrada. In: Schill O (Ed.) Water Bears: The Biology of Tardigrades. Zoological Monographs, Springer, 95–114. https://doi.org/10.1007/978-3-319-95702-9_3

Jørgensen A, Møbjerg N, Kristensen RM (2007) A molecular study of the tardigrade Echiniscus testudo (Echiniscidae) reveals low DNA sequence diversity over a large geographical area. Journal of Limnology 66(S1): 77–83. https://doi.org/10.4081/jlimnol.2007.s1.77

Jørgensen A, Møbjerg N, Kristensen RM (2011) Phylogeny and evolution of the Echiniscidae (Echiniscoidea, Tardigrada) – an investigation of the congruence between molecules and morphology. Journal of Zoological Systematics and Evolutionary Research 49(S1): 6–16. https://doi.org/10.1111/j.1439-0469.2010.00592.x

Kaczmarek Ł, Michalczyk Ł (2002) Echiniscus barbarae, a new species of tardigrade from Cuba Island (Tardigrada: Heterotardigrada, Echiniscidae, ‘arctomys group’). Zootaxa 53: 1–4. https://doi.org/10.11646/zootaxa.53.1.1

Kaczmarek Ł, Michalczyk Ł (2010) The genus Echiniscus Schultze 1840 (Tardigrada) in Costa Rican (Central America) rain forests with descriptions of two new species. Tropical Zoology 23: 91–106.

Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059–3066. https://doi.org/10.1093/nar/gkf436

Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Briefings in Bioinformatics 9: 286–298. https://doi.org/10.1093/bib/bbn013

Kitayama K (1992) An altitudinal transect study of the vegetation on Mount Kinabalu, Borneo. Vegetatio 102: 149–171. https://doi.org/10.1007/BF00044731

Kristensen RM (1987) Generic revision of the Echiniscidae (Heterotardigrada), with a discussion of the origin of the family. In: Bertolani R (Ed.) Biology of Tardigrades. Selected Symposia and Monographs U.Z.I., Modena, 261–335.

Kristensen RM, Hallas TE (1980) The tidal genus Echiniscoides and its variability, with erection of Echiniscoididae fam. n. (Tardigrada). Zoologica Scripta 9: 113–127. https://doi.org/10.1111/j.1463-6409.1980.tb00657.x

Kumar S, Stecher G, Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33: 1870–1874. https://doi.org/10.1093/molbev/msw054

Li X (2007) Tardigrades from the Tsinling Mountains, central China with descriptions of two new species of Echiniscidae (Tardigrada). Journal of Natural History 41: 2719–2739. https://doi.org/10.1080/00222930701711046

Lohman DJ, de Bruyn M, Page T, von Rintelen K, Hall R, Ng PKL, Shih H-T, Carvalho GR, von Rintelen T (2011) Biogeography of the Indo-Australian Archipelago. Annual Review of Ecology, Evolution, and Systematics 42: 205–226. https://doi.org/10.1146/annurev-ecolsys-102710-145001

Merckx VSFT, Hendriks KP, Beentjes KK, Mennes CB, Becking LE, Peijnenburg KTCA, Afendy A, de Boer ANH, Biun A, Buang MM, Chen P, Chung AYC, Dow R, Feijen FAA, Feijen H, Feijen-van Soest C, Geml J, Geurts R, Gravendeel B, Hovenkamp P, Imbun P, Ipor I, Janssens SB, Jocqué M, Kappes H, Khoo E, Koomen P, Lens F, Majapun RJ, Morgado LN, Neupane S, Nieser N, Pereira JT, Rahman H, Sabran S, Sawang A, Schwallier RM, Shim P, Smit H, Sol N, Spait M, Stech M, Stokvis F, Sugau JB, Suleiman M, Sumail S, Thomas DC, van Tol J, Tuh FYY, Yahya BE, Nais J, Repin R, Lakim M, Schilthhuizen M (2015) Evolution of endemism on a young tropical mountain. Nature 524: 347–350. https://doi.org/10.1038/nature14949

Michalczyk Ł, Kaczmarek Ł (2007) Echiniscus ganczareki, a new species of Tardigrada (Heterotardigrada: Echiniscidae, bigranulatus group) from Costa Rica. Zootaxa 1471: 15–25. https://doi.org/10.11646/zootaxa.1471.1.2

Miller WR, Claxton SK, Heatwole HF (1999) Tardigrades of the Australian Antarctic Territories: Males in the genus Echiniscus (Tardigrada: Heterotardigrada). Zoologischer Anzeiger 238: 303–309.

Mitchell CR, Romano FA (2007) Sexual dimorphism, population dynamics and some aspects of life history of Echiniscus mauccii (Tardigrada; Heterotardigrada). Journal of Limnology 66 (Supplement 1): 126–131. https://doi.org/10.4081/jlimnol.2007.s1.126

Moon SN, Kim HS (1990) A new species of Echiniscus (Tardigrada: Echiniscidae) from Korea. Korean Journal of Systematic Zoology 6: 231–234.

Mora C, Tittensor DP, Adl S, Simpson AGB, Worm B (2011) How many species are there on Earth and in the ocean? PLoS Biology 9: e1001127. https://doi.org/10.1371/journal.pbio.1001127

Møbjerg N, Kristensen RM, Jørgensen A (2016) Data from new taxa infer Isoechiniscoides gen. nov. and increase the phylogenetic and evolutionary understanding of echiniscoidid tardigrades (Echiniscoidea: Tardigrada). Zoological Journal of the Linnean Society 178: 804–818. https://doi.org/10.1111/zoj.12500

Ohsawa M, Nainggolan PHJ, Tanaka N, Anwar C (1985) Altitudinal zonation of forest vegetation on Mount Kerinci, Sumatra: with comparisons to zonation in the temperate region of east Asia. Journal of Tropical Ecology 1: 193–216. https://doi.org/10.1017/S0266467400000286

Pilato G, Binda MG, Lisi O (2004) Famelobiotus scalicii, n. gen. n. sp., a new eutardigrade from Borneo. New Zealand Journal of Zoology 31: 57–60. https://doi.org/10.1080/03014223.2004.9518359

Pilato G, Fontoura P, Lisi O, Beasley C (2008) New description of Echiniscus scabrospinosus Fontoura, 1982, and description of a new species of Echiniscus (Heterotardigrada) from China. Zootaxa 1856: 41–54. https://doi.org/10.11646/zootaxa.1856.1.4

Pleijel F, Jondelius U, Norlinder E, Nygren A, Oxelman B, Schander C, Sundberg P, Thollesson M (2008) Phylogenies without roots? A plea for the use of vouchers in molecular studies. Molecular Phylogenetics and Evolution 48: 369–371. https://doi.org/10.1016/j.ympev.2008.03.024

Rambaut A, Suchard MA, Xie D, Drummond AJ (2014) Tracer v1.6. https://beast.bio.ed.ac.uk/Tracer

Rebecchi L, Altiero T, Eibye-Jacobsen J, Bertolani R, Kristensen RM (2008) A new discovery of Novechiniscus armadilloides (Schuster, 1975) (Tardigrada, Echiniscidae) from Utah, USA with considerations on non-marine Heterotardigrada phylogeny and biogeography. Organisms, Diversity & Evolution 8: 58–65. https://doi.org/10.1016/j.ode.2006.11.002

Richters F (1902) Beiträge zur Kenntnis der Fauna der Umgebung von Frankfurt a. M. Bericht über die Senckenbergische Naturforschende Gesellschaft in Frankfurt am Main, 23–26.

Richters F (1904) Arktische tardigraden. Fauna Arctica 3: 495–511.

Riggin GT (1962) Tardigrada of the Southwest Virginia: with the addition of a description of a new marine species from Florida. Virginia Agricultural Experiment Station Technical Bulletin 152: 1–147.

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. https://doi.org/10.1093/bioinformatics/btg180

Stec D, Morek W, Gąsiorek P, Michalczyk Ł (2018) Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Systematics and Biodiversity 16: 357–376. https://doi.org/10.1080/14772000.2018.1424267

Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł (2015) An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052: 501–526. https://doi.org/10.11646/zootaxa.4052.5.1

van Steenis CGGJ (1984) Floristic altitudinal zones in Malesia. Botanical Journal of the Linnean Society 89: 289–292. https://doi.org/10.1111/j.1095-8339.1984.tb02560.x

Vecchi M, Cesari M, Bertolani R, Jönsson KI, Rebecchi L, Guidetti R (2016) Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebrate Systematics 30: 303–322. https://doi.org/10.1071/IS15033

Vicente F, Fontoura P, Cesari M, Rebecchi L, Guidetti R, Serrano A, Bertolani R (2013) Integrative taxonomy allows the identification of synonymous species and the erection of a new genus of Echiniscidae (Tardigrada, Heterotardigrada). Zootaxa 3613: 557–572. https://doi.org/10.11646/zootaxa.3613.6.3

Supplementary materials

Supplementary material 1

Raw morphometric data for the type population

Piotr Gąsiorek, Katarzyna Vončina, Łukasz Michalczyk

Data type: morphometric data

Explanation note: The dataset comprises individual measurements provided separately for all life stages.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (233.42 kb)

Supplementary material 2

Uncorrected pairwise distances

Piotr Gąsiorek, Katarzyna Vončina, Łukasz Michalczyk

Data type: genetic data

Explanation note: p-distances between haplotypes of fastly evolving DNA fragments (ITS-1, ITS-2, COI) provided for the members of the virginicus complex.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (18.27 kb)