Research Article |
|
Corresponding author: Marc Domènech ( mdomenan@gmail.com ) Academic editor: Danilo Harms
© 2020 Marc Domènech, Luís C. Crespo, Alba Enguídanos, Miquel A. Arnedo.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Domènech M, Crespo LC, Enguídanos A, Arnedo MA (2020) Mitochondrial discordance in closely related Theridion spiders (Araneae, Theridiidae), with description of a new species of the T. melanurum group. Zoosystematics and Evolution 96(1): 159-173. https://doi.org/10.3897/zse.96.49946
|
The incorporation of molecular data into current taxonomic practise has unravelled instances of incongruence among different data sets. Here we report a case of mitochondrial discordance in cobweb spiders of the genus Theridion Walckenaer, 1805 from the Iberian Peninsula. Morphological examination of samples from a country-wide bioinventory initiative revealed the existence of a putative new species and two nominal species belonging to the Theridion melanurum species group. The morphological delineation was supported by the molecular analysis of a nuclear marker but was at odds with the groups circumscribed by a mitochondrial marker. The causes of this discordance remained uncertain, once sample and sequencing errors and the existence of pseudogenes were discarded. The full sorting observed in the alleles of the more slowly evolving nuclear marker ruled out incomplete lineage sorting, while the geographic patterns recovered were difficult to reconciliate with ongoing hybridization. We propose that the apparent incongruence observed is most likely the result of old introgression events in a group with high dispersal abilities. We further speculate that endosymbiont-driven cytoplasmatic incompatibility could be involved in the fixation of mitochondrial haplotypes across species barriers. Additionally, we describe the new species T. promiscuum sp. nov., based on the presence of diagnostic morphological traits, backed up by the nuclear data delimitation. Our study contributes yet another example of the perils of relying on single methods or data sources to summarise the variation generated by multiple processes acting through thousands of years of evolution and supports the key role of biological inventories in improving our knowledge of invertebrate biodiversity.
COI, hybridization, Iberian Peninsula, incomplete lineage sorting, introgression, ITS2, Wolbachia
The incorporation of DNA sequence information in species delimitation and description has become a gold standard in current taxonomic practise. Under an integrative taxonomy framework (
Hybridization and incomplete lineage sorting are among the main processes accounting for the apparent incongruence between different sources of taxonomic evidence, namely mitochondrial DNA, nuclear DNA, or the phenotype. Hybridization is defined as the interbreeding of individuals from different species. When this hybridization process involves repeated backcrossing of the hybrids with the parent species, we talk about introgression. The notion that species boundaries are not impermeable but can be porous to introgression is becoming more and more accepted as new evidence appears (
Introgression between species can be detected by comparing information from mitochondrial (mtDNA) and nuclear DNA (nucDNA). As mtDNA is maternally inherited (
Another source of incongruence among multiple lines of taxonomic evidence in closely related species is incomplete lineage sorting (ILS). ILS is the process by which, as a result of the segregation of an ancestral polymorphism, i.e. the existence of two or more homologous alleles predating the speciation event, the evolutionary relationships between individuals given by the sequences of a certain gene do not match the species phylogeny (
The family Theridiidae is one of the richest and most ecologically diverse spider families, containing 2,516 species grouped in 124 genera (World Spider Catalog 2020). The family is reputed for including, among others, species of medical importance, such as the widow spiders (Latrodectus Walckenaer, 1805), or some of the few examples of sociability within spiders (e.g. Anelosimus Simon, 1891). Theridiids usually construct tangle webs with gumfoots, i.e. sticky droplets on silk threads radiating from mesh retreats or web hubs attached to the substrate, mainly aimed at capturing pedestrian prey (
The genus Theridion Walckenaer, 1805 contains 584 described species, more than one-fifth of all the theridiids found worldwide (World Spider Catalog 2020). This remarkable species diversity is most likely a taxonomic artifact because the genus has been traditionally used as a dumping ground for theridiids with no trace of colulus that do not fit into better diagnosed genera (
In the general framework of a biological inventory of the spider communities of white oak woodlands of the Spanish National Park Network (
Specimens were collected using semi-quantitative methods as part of a larger project that aimed to understand the diversity patterns of Iberian spider communities (
Specimens were sorted and identified under a ZEISS Stemi 2000 stereomicroscope. We took photographs using a Leica DFC 450 camera attached to a Leica MZ 16A stereomicroscope, with the software Leica Application Suite v. 4.4. Both the male palp and the female epigyne were excised with the help of entomological needles to facilitate observation under the scope. The muscle tissue of the epigyne was further removed with the needles and digested using immersion in potassium hydroxide (KOH) at a 30% concentration. For SEM examination, palps were excised and cleaned ultrasonically for 1 min and then transferred to 100% ethanol overnight. Palps were submitted to critical point drying, glued to flat-headed rivets and gold sputter coated. Imaging was conducted with the help of a Quanta 200 environmental SEM. We used the Araneae: Spiders of Europe online identification tool to identify most of the species found in our samples (Nentwig et al. 2019). Type specimens were deposited at Museu de Ciències Naturals de Barcelona, Spain (
For molecular analyses, we aimed at including both sexes and all the sites were each species was collected. We extracted DNA from two to four legs from each specimen using REDExtract-N-Amp™ Tissue PCR Kit Protocol from Sigma-Aldrich, following the manufacturer’s protocol, performed in 96-well plates. We amplified fragments of the animal DNA barcode gene cytochrome c oxidase subunit I (COI) and the nuclear Internal Transcribed Spacer 2 (ITS2). Primers used for amplification are shown in Table
| Target | Primer name | Direction | Sequence | Reference |
|---|---|---|---|---|
| COI | LCOI1490 | Forward | GGTCAACAAATCATAAAGATATTGG |
|
| COI | HCOI2198 | Forward | TAAACTTCAGGGTGACCAAAAAATCA |
|
| COI | Nancy | Reverse | CCCGGTAAAATTAAAATATAAACTTC |
|
| ITS2 | ITS-5.8S | Forward | GGGACGATGAAGAACGGAGC |
|
| ITS2 | ITS-28S | Reverse | TCCTCCGCTTATTGATATGC |
|
We edited and manipulated all sequences using Geneious v. 10.2 (
We inferred a Maximum Likelihood tree for the COI with the program RAxML (
We conducted additional species delineation using the barcode index number (BIN) method (
Among the 8521 adult spiders collected in the inventorying samples, we identified 404 specimens of the genus Theridion, corresponding to four nominal species, namely T. mystaceum (65 males, 120 females), T. harmsi (42 males, 138 females), T. varians Hahn, 1833, (14 males, 10 females), and T. pinastri L. Koch, 1872 (2 males). In addition, we found two morphotypes that did not fit into any of the nominal species descriptions, tentatively referred to as T. sp. 6 (seven males, five females) and T. sp. 15 (one male). The former was found to be a new species to science, hereby described.
We obtained the COI sequences of 117 specimens (31 T. mystaceum, 59 T. harmsi, 18 T. varians, two T. pinastri, six T. sp. 6, and one T. sp. 15) and ITS2 sequences of 73 specimens (30 T. mystaceum, 30 T. harmsi, five T. varians, one T. pinastri, six T. sp. 6, and one T. sp. 15). In addition, we downloaded seven COI sequences belonging to the T. melanurum group available at NCBI, namely five T. mystaceum (KX537283, KY268733, KY269206, KY269434, and KY270001), one T. melanurum (EF449609), and one T. betteni (KX039404), as well as one ITS2 sequence belonging to T. varians (KR526552) (
The ML tree obtained for the COI (Fig.
Inferred maximum-likelihood tree of the Theridion DNA barcode sequences. Black dots indicate bootstrap support higher than 80%. Colour boxes enclose species delimited with morphology. Labels on the right side indicate BIN number assigned by BOLD. Letters after species names indicate locality and sex. A – Aigüestortes i Estany de Sant Maurici; C – Cabañeros; Gr – Germany; M – Monfragüe; O – Ordesa y Monte Perdido; P – Picos de Europa; S – Sierra Nevada; Sw – Switzerland; Uk – United Kingdom.
The COI sequences were split into nine different BINs, one unique and the remaining including additional specimen available in BOLD. The species delineation of the T. melanurum complex yielded either BINs with mixed species (Fig.
The COI haplotype network (Fig.
In contrast to the mitochondrial network, the nuclear ITS2 network perfectly matched the morphology-based species delimitations (Fig.
The ITS2 maximum uncorrected intraspecific divergences ranged between 0 and 4.5% (Table
The combination of diagnostic morphological features both in males and females, similar to those found among other species within the T. melanaurum group, and the additional support of the nuclear data delimitation led us to propose that T. sp. 6 morphotype actually corresponds to a new species.
COI haplotype network. Labels next to the circles indicate the park or country where the specimens were collected: A – Aigüestortes i Estany de Sant Maurici; C – Cabañeros; Gr – Germany; M – Monfragüe; O – Ordesa y Monte Perdido; P – Picos de Europa; S – Sierra Nevada; Sw – Switzerland; Uk – United Kingdom.
ITS2 maximum intraspecific sequence divergences in previously published studies. Species in bold correspond to species within the T. melanurum group.
| Species | Maximum intraspecific sequence divergence | Reference |
|---|---|---|
| Latrodectus katipo | 0.002 |
|
| Latrodectus hasselti | 0 |
|
| Latrodectus hasselti | 0.0027 |
|
| Latrodectus mactans | 0.014 |
|
| Anelosimus eximius | 0.007 |
|
| Anelosimus domingo | 0 |
|
| Anelosimus tosum | 0.008 |
|
| Anelosimus studiosus | 0.01 |
|
| Anelosimus guacamayos | 0.002 |
|
| Anelosimus octavius | 0.007 |
|
| Anelosimus baeza | 0.02 |
|
| Theridion harmsi | 0.045 | This study |
| Theridion mystaceum | 0 | This study |
| Theridion promiscuum sp. nov. | 0.002 | This study |
| Theridion varians | 0.004 | This study |
| T. melanurum group | 0.154 | This study |
ITS2 minimum interspecific sequence divergences. Values from previously published studies are comparisons between sister species within the corresponding genus. Species in bold correspond to species within the T. melanurum group.
| Family | Species | Minimum interspecific sequence divergence | Reference |
|---|---|---|---|
| Theridiidae | Anelosimus sp. | 0.006 |
|
| Theridiidae | Latrodectus sp. | 0 |
|
| Theridiidae | Latrodectus sp. | 0 |
|
| Linyphiidae | Orsonwelles sp. | 0.007 |
|
| Araneidae | Poltys sp. | 0.007 |
|
| Salticidae | Havaika sp. | 0.02 |
|
| Lycosidae | Pardosa sp. | 0.025 |
|
| Theridiidae | T. harmsi – T. mystaceum | 0.033 | This study |
| Theridiidae | T. harmsi – T. promiscuum sp. nov. | 0.043 | This study |
| Theridiidae | T. mystaceum – T. promiscuum sp. nov. | 0.026 | This study |
Holotype ♂: Spain, Parc Nacional d’Aigüestortes i Estany de Sant Maurici, 42.5491, 0.8714, 1739 m. Hand collecting, June 30, 2013 (Marcos Roca-Cusachs leg.). Deposited at
Paratypes: 6♂ and 5♀ from Spain, Parc Nacional d’Aigüestortes i Estany de Sant Maurici, 0.8725, 42.5496, 1760 m. June 29, 2013. Four males and three females deposited at
The specific name promiscuum is derived from the Latin word for “intermingling”, referring to the morphological similarity with other species of the T. melanurum group. It also makes reference to the possible introgression between this species and other closely related species here reported.
Males of T. promiscuum sp. nov. can be distinguished from other species in T. melanurum group by a bent and twisted embolus, forming a marked angle (Fig.
Theridion promiscuum sp. nov. a) Female paratype MZB 2019-1688, dorsal habitus. b) Male paratype MZB 2017-3713, dorsal habitus. c) Left male palp, ventral. d) Left male palp, retrolateral e) Male embolus f) Female epigynum, ventral g) Female vulva, dorsal. Scale bars: 1 mm (a, b); 0.1 mm (c, d, f, g); 0.05 mm (e).
Holotype male: Total length 1.81; abdomen 1.04; cephalothorax length 0.84, width 0.78. Leg length (total, coxa, trochanter, femur, patella, tibia, metatarsus, tarsus): I: 4.46, 0.22, 0.16, 1.18, 0.42, 0.97, 1.02, 0.5; II: 3.38, 0.2, 0.11, 0.91, 0.37, 0.63, 0.75, 0.41; III: 2.49, 0.16, 0.08, 0.69, 0.3, 0.4, 0.53, 0.34; IV: 3.32, 0.21, 0.1, 0.98, 0.38, 0.56, 0.7, 0.39. Leg formula: 1>2>4>3. Eye diameter: AME 0.07; ALE 0.06; PME 0.06; PLE 0.07. Distance from AME to clypeus 0.18. Length of chelicera 0.26, fang 0.14. Dark circles around the eyes, with eye region darker than the rest of carapace. Carapace yellowish brown, with blackish triangular patch not reaching the eyes (see paratype MZB 2017-3713; Fig.
Paratype female (MZB 2019-1688): Total length 2.18; abdomen 1.33; cephalothorax length 0.93, width 0.84. Leg lengths (total, coxa, trochanter, femur, patella, tibia, metatarsus, tarsus): I: 4.74, 0.24, 0.14, 1.28, 0.45, 1.01, 1.13, 0.5; II: 3.42, 0.24, 0.1, 0.94, 0.37, 0.61, 0.76, 0.41; III: 2.65, 0.22, 0.08, 0.74, 0.3, 0.39, 0.57, 0.36; IV: 3.7, 0.29, 0.1, 1.08, 0.38, 0.63, 0.82, 0.41. Leg formula: 1>2>4>3. Eye diameters: AME 0.08; ALE 0.07; PME 0.06; PLE 0.07. Distance from AME to clypeus 0.17. Length of chelicera 0.34, fang 0.13. Spine-like bristles in leg I: 2 in patella, 2 in tibia. Relative positions in tibia I: 0.25, 0.68. Thickness of tibia I: 0.1. Serrated bristles on tarsus of fourth leg. Cephalothorax yellowish brown with a black central area reaching the eye region, and broad, dark edge (Fig.
Spine-like bristles in tibia of leg I of paratypes: two in patella, two in tibia. Relative positions of first spine in tibia: 0.25–0.32 (average 0.275). Relative positions of second spine in tibia: 0.7–0.74 (average 0.717). Thickness of tibia I: 0.11–0.13 (average 0.123).
We obtained a 568 bp sequence of the COI mitochondrial gene for the holotype (stored in Genbank under the code MT215600) and five paratypes (MZB 2017-3710, MZB 2017-3712, MZB 2017-3713, MZB 2017-3714, and MZB 2017-4570 with GenBank codes MT215603, MT215604, MT215602, MT215606 and MT215601, respectively). We also obtained sequences of the ITS2 of up to 469 bp, including up to 26 bp of the 28S gene and up to 69 bp of the 5.8S gene, for the holotype (GenBank code MT117179) and the five paratypes mentioned before (codes MT117182, MT117181, MT117180, MT117183 and MT117184).
The holotype and paratypes were collected in an oak forest of Quercus pubescens Willd. in Aigüestortes i Estany de Sant Maurici National Park, located in the southern slopes of the Catalan Pyrenees. The specimens were captured either by beating, sweeping or direct sampling, but not by pitfall traps, which suggests that this species is found in the vegetation at a certain height above the ground. Only the three specimens captured by beating method were captured during the day, whereas the sweeping and direct sampling ones were captured at night, which indicates that this species is mostly active at night.
The specimen tentatively referred to as T. sp. 15 is morphologically similar to the species T. cinereum Thorell, 1875, T. petraeum L. Koch, 1872, T. furfuraceum Simon, 1914, T. pyrenaeum Denis, 1944, and T. wiehlei Schenkel, 1938. However, the male palp of the single specimen available showed slight differences in the shape of the median apophysis, slightly tilted, and the more pronounced basal curvature of the shorter embolus, which refrained us from assigning it to any of the former species. The DNA barcodes, on the other hand, identified the specimen unambiguously as T. cinereum.
The genus Theridion is already one of the largest genera within spiders, yet new species continue to be described yearly, with no evidence of reaching a plateau. Surprisingly, even the well-known European fauna is still contributing new Theridion species. The newest, T. bernardi, also belonging to the T. melanurum group, was described from Portugal in 2017 (
Our data clearly shows that while the phenotype and the nuclear data nicely delimit species boundaries in the studied species, the mitochondrial data suggest mixture across members of the T. melanurum group. The most obvious explanation for the apparent incongruence would be the human error in the manipulation of specimens or in the lab procedures. We discarded this source of error by re-extracting and resequencing specimens involved at least twice, independently. On the other hand, it is well known that mitochondrial pseudogenes, either as duplications within the mitochondrial genome or as copies inserted into the nuclear genome (e.g. NUMTS) may compromise the recovery of species boundaries using DNA barcoding approaches (
Among the biological processes that may account for inconsistencies among different molecular markers, the incomplete sorting of ancestral polymorphism seems unlikely in our case. At least in spiders, the higher mutation rates and smaller population sizes of mitochondrial markers should ensure sorting in those markers previous to the nuclear ones, an opposite pattern of the one here reported. Although slower evolutionary rates in mitochondrial DNA have been found in some tetrapods (
Although at the moment we lack any solid evidence, there are also some chances that the mitochondrial incongruence observed could have been maintained by the involvement of endosymbiont driven cytoplasmic incompatibility. It is well known that endosymbiotic bacteria may affect the patterns of mitochondrial variation in invertebrates, which may compromise the inferences made on host evolution from these patterns (
The genus Theridion is a classic example of catch-all genus, a poorly defined group to include species with no trace of colulus that do not match other more precisely diagnosed genera. The redefinition of the genus would require an exhaustive systematic revision of a thorough sample of species, which is beyond the scope of the present paper. However, our results do support the existence of complexes of species within the genus. Specifically, molecular data (Fig.
We investigated here one of the few cases reported of mitochondrial discordance within spiders. A countrywide bioinventorying project revealed the existence of a new, morphologically diagnosable spider species within the T. melanurum group. Subsequent mtDNA barcode screening of specimens, however, identified instances of haplotype mixing across closely related species. Molecular information from a nuclear marker, on the other hand, supported the morphological delimitations, including the new specific status. The lack of geographic structure in the shared haplotypes and the lack of sorting in the fastest evolving gene suggests that mechanisms other than ongoing gene flow and deep coalescence are responsible for the observed patterns. We propose that cytoplasmatic incompatibility mediated by endosymbionts may have been instrumental in generating mito-nuclear discordance, probably originated from old introgression events. Finally, this study highlights the important role that bioinventories play in improving our knowledge of biodiversity, especially in a time when fieldwork studies that gather new data are becoming less popular than those using pre-existing data, like modelling or meta-analysis studies (
Collections were conducted under the corresponding permits kindly provided by the following individuals and institutions: Miguel M. de la Hoz (Picos de Europa), Elena Villagrasa (Ordesa), Maria Merced Aniz Montes (Aigüestortes), Angel Rodriguez Martin (Monfragüe), Angel Gómez Manzaneque (Cabañeros), and Blanca Ramos Losada (Sierra Nevada). We are grateful to all the people that contributed in the samplings as well as to all the park rangers that supported us in the field. We also thank Jagoba Malumbres-Olarte for generating the map in Figure
Additional information on the Theridion specimens
Data type: Specimen information
Explanation note: Spreadsheet containing the collection site, collection code, and COI and 28S GenBank accession numbers of all the Theridion specimens used in this study.