Research Article |
|
Corresponding author: Aftab Ali Shah ( aftabuom@gmail.com ) Academic editor: Michael Ohl
© 2018 Aftab Ali Shah, Mushtaq Ahmad, Taqweem Ul-Haq.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Shah AA, Ahmad M, Ul-Haq T (2018) Deciphering conserved identical sequences of mature miRNAs among six members of great apes. Zoosystematics and Evolution 94(2): 401-408. https://doi.org/10.3897/zse.94.28099
|
MicroRNAs (miRNAs) are a group of small RNA molecules which act as negative regulators of gene expression by controlling post-transcriptional regulation through binding to their corresponding mRNAs. Due to their small size, their nucleotide compositions are expected to be similar, but until now, the extent of similarity has not been reported in humans and their six phylogenetically closely related members of hominids. The present study allows direct comparison among six members of hominid species (Homo sapiens, Gorilla gorilla, Pan paniscus, Pongo pygmaeus, Pan troglodytes and Symphalangus syndactylus) in terms of their miRNA repertoire, their evolutionary distance to human, as well as, the categorization of identical species-specific miRNAs. For this purpose, a total of 2694, 370, 157, 673, 590 and 10 mature miRNA sequences of Homo sapiens, Gorilla gorilla, Pan paniscus, Pongo pygmaeus, Pan troglodytes and Symphalangus syndactylus respectively were retrieved from miRbase 22. A total of 12, 4, 4 and 3 conserved clusters with identical miRNA sequences that belong to the same gene families were found in Homo sapiens, Gorilla gorilla, Pongo pygmaeus, Pan troglodytes respectively by neighbor-joining method using MEGA7 software. Interestingly, cross-species comparison has also shown a set of conserved identical miRNA sequences. Homologs of human mature miRNAs with 100% sequence identity are expected to have similar functions in the studied primates. Further in-vitro study is required to investigate common targets for identical miRNAs in the studied primates.
Molecular evolution, Gene regulation, Pre-miRNA, microRNA
MiRNAs are small (19–23nt) RNA molecules that regulate messenger RNA through binding to their 3’-UTR, mediated by the RNA induced silencing (RISC) complex in all living organisms (
It is already known that multiple miRNAs are produced from the same primary transcript and majority of miRNA clusters are transcribed as a single unit (
Among the six members of great apes, Homo sapiens are the deepest explored group with 2694 mature miRNAs miRNAs described. In the present study, we took advantage of a recently available set of mature miRNA from six members of the great ape population to systematically detect identical miRNA by comparing patterns of intra- and inter-species sequence similarity and their evolutionary distance. Interestingly, it was found that intra- and inter-species sequence set of identical mature miRNA exists in great apes including humans. Further in-vitro study is required to investigate common targets for identical miRNAs in the studied primates.
For miRNA, a very limited open and free data is available. The miRBase is one of the highly referred databases, easily accessible and in its latest release 10883 pre-miRNAs are available. Dataset of mature miRNAs sequences of Homo sapiens (no=2694), Gorilla gorilla (no=370), Pan paniscus (no=157), Pongo pygmaeus (no=673 mature), Pan troglodytes (no=590 mature) and Symphalangus syndactylus (no=10 mature) were retrieved from miRBase sequence database (a data repository of published miRNA sequences and its annotation) (release 22.0) at http://microrna.sanger.ac.uk. ClustalW was used to generate multiple alignments of nucleic acid sequences (
Homologous sequences in Homo sapiens were clustered based on their phylogenetic relationship and sequence identity using ClustalW. Multiple alignment of mature miRNAs revealed a conserved consensus. Neighbor-Joining method was used for inferring the evolutionary history. The optimal tree with the sum of branch length = 2.32453654 is shown in Figure
List of miRNAs grouped into clusters, their genomic coordinates, gene family names and their matured miRNA sequences in Homo sapiens.
| S. No | Members | Gene Family Name | Genomic coordinate | Mature miRNA sequence |
|---|---|---|---|---|
| Cluster 1 | hsa-miR-523-5p | MIPF0000020; mir-515 | chr19: 53698385-53698471 [+] | CUCUAGAGGGAAGCGCUUUCUG |
| hsa-miR-519b-5p | chr19: 53695213-53695293 [+] | |||
| hsa-miR-519a-5p | chr19: 53752397-53752481 [+] | |||
| hsa-miR-518e-5p | chr19: 53729838-53729925 [+] | |||
| hsa-miR-522-5p | chr19: 53751211-53751297 [+] | |||
| hsa-miR-519c-5p | chr19: 53686469-53686555 [+] | |||
| Cluster 2 | hsa-miR-519a-2-5p | chr19: 53762344-53762430 [+] | CUGCAAAGGGAAGCCCUUUC | |
| hsa-miR-519b-2-5p | chr19: 53754018-53754102 [+] | |||
| Cluster 3 | hsa-miR-518a-5p | chr19: 53731006-53731090 [+] | ||
| hsa-miR-527 | chr19: 53754018-53754102 [+] | |||
| Cluster 4 | hsa-miR-517a-3p | chr19: 53712268-53712354 [+] | AUCGUGCAUCCCUUUAGAGUGU | |
| hsa-miR-517b-3p | chr19: 53721076-53721142 [+] | |||
| Cluster 5 | hsa-miR-516a-3p | chr19: 53756741-53756830 [+] | UGCUUCCUUUCAGAGGGU | |
| hsa-miR-516b-3p | chr19: 53736845-53736934 [+] | |||
| Cluster 6 | hsa-miR-3689e | MIPF0001144; mir-3689 | chr9: 134850570-134850641 [-] | UGUGAUAUCAUGGUUCCUGGGA |
| hsa-miR-3689a-5p | chr9: 134849487-134849564 [-] | |||
| Cluster 7 | hsa-miR-3689b-3p | chr9: 134850125-134850272 [-] | CUGGGAGGUGUGAUAUUGUGGU | |
| hsa-miR-3689c | chr9: 134849298-134849369 [-] | |||
| Cluster 8 | hsa-miR-548c-5p | MIPF0000317; mir-548 | chr12: 64622509-64622605 [+] | AAAAGUAAUUGCGGUUUUUGCC |
| hsa-miR-548am-5p | chrX: 16627012-16627085 [-] | |||
| hsa-miR-570-5p | chr3: 195699401-195699497 [+] | AAAGGUAAUUGCAGUUUUUCCC | ||
| Cluster 9 | hsa-miR-548ai | chr6: 99124609-99124696 [+] | ||
| Cluster 10 | hsa-miR-548h-3p | chr8: 27048853-27048963 [-] | CAAAAACCGCAAUUACUUUUGCA | |
| hsa-miR-548z | chr12: 64622509-64622605 [-] | |||
| Cluster 11 | hsa-miR-199a-3p | MIPF0000040; mir-199 | chr19: 10817426-10817496 [-] | ACAGUAGUCUGCACAUUGGUUA |
| hsa-miR-199b-3p | chr9: 128244721-128244830 [-] | |||
| Cluster 12 | hsa-miR-365b-3p | MIPF0000061; mir-365 | chr17: 31575411-31575521 [+] | UAAUGCCCCUAAAAAUCCUUAU |
| hsa-miR-365a-3p | chr16: 14309285-14309371 [+] |
List of miRNAs grouped into clusters, their genomic coordinates, gene family names and their matured miRNA sequences in Gorilla gorilla.
| S. No | No. of members | Gene family | Genomic coordinate | Mature miRNA sequence |
|---|---|---|---|---|
| Cluster 1 | ggo-miR-522-5p | MIPF0000020; mir-515 | chr19: 53095952-53096058 [+] | CUCUAGAGGGAAGCGCUUUCUG |
| ggo-miR-519c-5p | chr19: 53038851-53038969 [+] | |||
| ggo-miR-519a-5p | chr19: 53097153-53097260 [+] | |||
| ggo-miR-518e-5p | chr19: 53073319-53073416 [+] | |||
| ggo-miR-523-5p | chr19: 53042042-53042160 [+] | |||
| Cluster 2 | ggo-miR-518d-5p | chr19: 53078317-53078435 [+] | ||
| ggo-miR-526a | chr19: 53069990-53070073 [+] | |||
| ggo-miR-520c | chr19: 53049906-53050015 [+] | |||
| Cluster 3 | ggo-miR-516a-5p | chr19: 53101171-53101280 [+] | UUCUCGAGGAAAGAAGCACUUUC | |
| ggo-miR-516a | chr19: 53105582-53105691 [+] | |||
| Cluster 4 | ggo-miR-520f | chr19: 53025391-53025489 [+] | AAGUGCUUCCUUUUAGAGGGUU | |
| ggo-miR-519b | chr19: 53044871-53044969 [+] |
List of miRNAs grouped into clusters, their genomic coordinates, gene family names and their matured miRNA sequences in Pongo pygmaeus.
| S. No | No. of members | Gene Family | Genomic coordinate | Mature miRNA sequence |
| Cluster 1 | ppy-miR-520i | MIPF0000020; mir-515 | chr19: 55513927-55514025 [+] | CUACAAAGGGAAGCCCUUUC |
| ppy-miR-520d-5p | chr19: 55491990-55492076 [+] | |||
| Cluster 2 | ppy-miR-518a-5p | chr19: 55505640-55505726 [+] | CUGCAAAGGGAAGCCCUUUC | |
| ppy-miR-527 | chr19: 55533164-55533250 [+] | |||
| Cluster 3 | ppy-miR-219 | MIPF0000044; mir-219 | NW_002874576.1: 1044940-1045049 [+] | UGAUUGUCCAAACGCAAUUCU |
| ppy-miR-219-5p | chr9: 125361031-125361127 [-] | |||
| Cluster 4 | ppy-miR-517c | MIPF0000020; mir-515 | chr19: 55485875-55485961 [+] | AUCGUGCAUCCCUUUAGAGUGU |
| ppy-miR-517c-3p |
List of miRNAs grouped into clusters, their genomic coordinates, gene family names and their matured miRNA sequences in Pan troglodytes.
| S. No | No. of members | Gene family | Genomic coordinate | Mature miRNA sequence |
|---|---|---|---|---|
| Cluster 1 | ptr-miR-1283b | MIPF0000020; mir-515 | chr19: 56105638-56105756 [+] | CUGCAAAGGGAAGCCCUUUC |
| ptr-miR-518g-5p | chr19: 56078436-56078532 [+] | |||
| ptr-miR-527 | chr19: 56101441-56101526 [+] | |||
| Cluster 2 | ptr-miR-520h | chr19: 56089945-56090033 [+] | ACAAAGUGCUUCCCUUUAGAGUGU | |
| ptr-miR-520g | chr19: 56069121-56069209 [+] | |||
| Cluster 3 | ptr-miR-199b | MIPF0000040; mir-199 | chr9: 106385739-106385847 [-] | ACAGUAGUCUGCACAUUGGUUA |
| ptr-miR-199a-3p | chr19: 11396978-11397047 [-] |
To assess whether any cross-species conserved miRNA in hominids exists, all known matured miRNAs were aligned to generate multiple alignments of nucleic acid sequences using ClustalW, and MEGA7 was used to generate phylogenetic analyses. The optimal tree with the sum of branch length = 3.16412289 is shown in Figure
MiRNA-mediated gene regulation is novel mechanism among all lineages in animal kingdom (
In this comparative study, conserved identical miRNA sequences were found among four hominid species. The applied prediction algorithm (mentioned in the materials and method section) proves several criteria based on similarity to identified conserved sequences of miRNAs to detect both more distantly-related and closely-related homologs. Further study is required to identify potential targets for identical miRNAs in the studied primates.
Conflict of interest: No conflict of interest exists.
Ethical approval: This article does not contain any study with human participants or animals performed by any of the authors.