Research Article
Print
Research Article
Rediscovery and phylogenetic analysis of Agnostrup, a least known genus of Mecistocephalidae (Chilopoda, Geophilomorpha) in China
expand article infoJia-bo Fan‡, Chun-Xue You‡, Chao Jiang§
‡ Tianjin Agricultural University, Tianjin, China
§ China Academy of Chinese Medical Sciences, Beijing, China

Corresponding author: Chun-Xue You ( youchunxue@mail.bnu.edu.cn )

Corresponding author: Chao Jiang ( jiangchao0411@126.com )

Academic editor: Martin Husemann
© 2024 Jia-bo Fan, Chun-Xue You, Chao Jiang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Fan J-bo, You C-X, Jiang C (2024) Rediscovery and phylogenetic analysis of Agnostrup, a least known genus of Mecistocephalidae (Chilopoda, Geophilomorpha) in China. Zoosystematics and Evolution 100(4): 1557-1568. https://doi.org/10.3897/zse.100.135994
ZooBank: urn:lsid:zoobank.org:pub:FD65E13C-0E85-49BF-A691-21E351EEF22E
Open Access

Abstract

The genus Agnostrup Foddai, Bonato, Pereira & Minelli, 2003 is one of the least known genera within the family Mecistocephalidae Bollman, 1893. In this study, we rediscovered the genus Agnostrup in China and provided a comprehensive redescription of A. striatus (Takakuwa, 1949). Additionally, we conducted a molecular phylogenetic analysis using CO1, 16S, and 28S sequence data, revealing a low genetic distance between Agnostrup and Nannarrup Foddai, Bonato, Pereira & Minelli, 2003. After comparing the morphological characteristics of these two genera, we synonymized the genus Nannarrup syn. nov. with Agnostrup. As a result, three species previously belonging to the genus Nannarrup were transferred to Agnostrup: A. hoffmani (Foddai et al., 2003), comb. nov., A. innuptus (Tsukamoto, 2022), comb. nov., and A. oyamensis (Tsukamoto, 2022), comb. nov.

Key Words

Agnostrup, description, Mecistocephalidae, molecular phylogeny, taxonomy

Introduction

The geophilomorph family Mecistocephalidae Bollman, 1893, recognized as a monophyletic basal clade, comprises approximately 170 species across 11 genera (Bonato et al. 2011). Within this family, three subfamilies are recognized: Mecistocephalinae Bollman, 1893; Dicellophilinae Cook, 1896; and Arrupinae Chamberlin, 1912. The Arrupinae includes four valid genera: Arrup Chamberlin, 1912; Agnostrup Foddai, Bonato, Pereira & Minelli, 2003; Partygarrupius Verhoeff, 1939; and Nannarrup Foddai, Bonato, Pereira & Minelli, 2003 (Foddai et al. 2003).

Agnostrup Foddai, Bonato, Pereira & Minelli, 2003, characterized by forcipular trochanteropraefemur with a well-developed tooth and 41 leg-bearing segments, is one of the least-known genera in the family Mecistocephalidae Bollman, 1893 (Foddai et al. 2003). This genus includes only three species recorded from temperate regions of East Asia: A. striatus (Takakuwa, 1949) from Shanxi, China; A. paucipes (Miyosi, 1955) from Matsuyama, Japan; and A. striganovae (Titova, 1975) from the nearby Sikhote-Alin mountains of Russia. Few articles about the morphology, distribution, ecology, or molecular phylogenetics of species from this genus have been documented since its original description. In particular, the type materials of Taiwanella paucipes and Taiwanella striata are considered to have been lost after examining many collections (Foddai et al. 2003; Uliana et al. 2007). The published accounts of its morphology are incomplete and contain ambiguous details, and the species’ distinguishing features have not been thoroughly examined.

Recently, we collected four specimens from Shanxi, China, that obviously belong to the genus Agnostrup. Based on a critical evaluation of published information and examination of fresh material, these specimens were identified as A. striatus; one of these specimens is selected and described here as the neotype for Taiwanella striata. We also revised the diagnostic characters of the genus Agnostrup and established the phylogenetic relationship of the family Mecistocephalidae based on the COI, 16S, and 28S sequence data. Molecular phylogenetics shows a close relationship between the genus Agnostrup and Nannarrup Foddai, Bonato, Pereira & Minelli, 2003. After comparing the morphological characters of these two genera, we synonymize the genus Nannarrup syn. nov. with Agnostrup.

Materials and methods

Biological sampling

Two adult male and two adult female specimens of Agnostrup spp. were collected from Shanxi Province, China (see additional geographic details below) in November 2023 and June 2024. These specimens were individually preserved in 75% ethanol and deposited in the herbarium of the National Resource Center for Chinese Materia Medica, China Academy of Chinese Medical Sciences (CMMI).

Morphological terminology for external anatomy follows Bonato et al. (2010). Taxonomic characters were examined in lactic acid and photographed using a Leica M205 FCA stereomicroscope (7.8–160×) or an Olympus BX51 microscope (100–400×). The photos were converted into hand-drawn illustrations with SKETCHBOOK 6.0.6.

DNA extractions and fragment amplification

Two body segments from each sample were used for DNA extraction. Following the manufacturer’s protocol, DNA was extracted using the DNeasy® Blood & Tissue Kit (QIAGEN GmbH, Germany). The polymerase chain reaction (PCR) was used to amplify the cytochrome c oxidase subunit I (COI), mitochondrial ribosomal gene 16S, and nuclear ribosomal DNA 28S fragments. PCR primers and programs are provided in Table 1.

Table 1.
Download as
CSV
XLSX

Primers and programs of PCR.

Loci Primers Sequence 5– 3 Program References
CO1 LCO1490 GGTCAACAAATCATAAAGATATTGG 2min at 94 °C; 35 cycles of 15s at 95 °C, 40s at 45–47 °C and 45s at 72 °C; 10min at 72 °C Folmer et al. 1994; Joshi and Karanth 2011
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
16S 16Sar CGCCTGTTTATCAAAAACAT 5min at 95 °C; 35 cycles of 30s at 95 °C, 30s at 55 °C and 1min at 72 °C; 3min at 72 °C Xiong and Kocher 1991
16Sb CTCCGGTTTGAACTCAGATC
28S 28SD1F GGGACTACCCCCTGAATTTAAGCAT 3min at 95 °C; 35 cycles of 30s at 95 °C, 30s at 65 °C and 1min at 72 °C; 3min at 72 °C Boyer and Giribet (2007); Edgecombe and Giribet (2006)
28SrD4b CCTTGGTCCGTGTTTCAAGAC

Genetic distance and molecular phylogenetic analyses

The genetic distance among genera of Mecistocephalidae was calculated using the Kimura 2-parameter model in MEGA X (Kumar et al. 2018).

Maximum-likelihood (ML) tree were constructed using the concatenated dataset with IQ-tree 1.6.12 (Nguyen et al. 2015). GTR+I+G4+F was selected as the preferred substitution model for ML, with 1,000,000 ultrafast bootstrap replicates (Hoang et al. 2018). Bayesian inference (BI) was conducted using MRBAYES 3.2.6 (Ronquist et al. 2012), with 10,000,000 bootstrap replicates. The GTR+F+I+G4 was chosen as the preferred model for BI, sampling every 1,000 generations and using 25% of the trees as burn-in. A split frequency of less than 0.01 was used to determine stationarity, and the consensus tree was constructed from the remaining trees.

Results

Molecular phylogenetic analyses

Sequences from the Agnostrup striatus, along with 16 other Mecistocephalidae samples from different genera and a sample from Geophilidae, were aligned. ML and BI analyses were utilized to construct phylogenetic trees for the combined COI+16S+28S dataset (Figs 1, 2). In the family Mecistocephalidae, the genera Agnostrup, Anarrup, Arrup, Nannarrup, and Partygarrupius, as well as the species Dicellophilus anomalus (Chamberlin, 1904), Dicellophilus pulcher (Kishida, 1928), and Dicellophilus praetermissus Tsukamoto & Eguchi, 2024, from the genus Dicellophilus, all have 41 leg-bearing segments. According to the phylogenetic tree, Agnostrup is the sister to Nannarrup (PP = 1; BS = 99%). While the genus Arrup is nested at the base of Mecistocephalidae in both ML and BI analyses (PP = 1). The genus Dicellophilus Cook, 1896 forms a clade with Proterotaiwanella + Tygarrup + Mecistocephalus in ML analyses, uncertain in BI analyses. The genus Proterotaiwanella Bonato, Foddai & Minelli, 2002 (subfamily Dicellophilinae) forms a clade with Tygarrup and Mecistocephalus (subfamily Mecistocephalinae) (PP = 1; BS = 85%), which is inconsistent with morphological results.

Figure 1. 

Maximum likelihood phylogenetic tree based on combined data for Mecistocephalidae. Values above the branches represent the bootstrap support (BS); BS < 70% are indicated as hyphens.

Figure 2. 

Bayesian inference based on combined data for Mecistocephalidae. Values above the branches represent the posterior probability (PP); PP < 0.9 is indicated as a hyphen.

Genetic distance among Agnostrup and other mecistocephalidae genus

In examining genetic distances within the Mecistocephalidae family, we focused on the Agnostrup genus and its relationship with other genera, using sequences from COI, 16S, and 28S mitochondrial DNA regions (Table 3). The average K2P genetic distance is 20.0% (COI), 25.9% (16S), and 11.68% (28S). The data showed distinct genetic differentiation, with Agnostrup displaying high genetic distances from the Tygarrup genus, marked by 22.2% for COI, 26.9% for 16S, and 11.8% for 28S, indicating significant evolutionary divergence. In contrast, genetic distances between Agnostrup and Nannarrup genera were notably lower at 16.4% for COI, 18.1% for 16S, and 10.6% for 28S. The mean K2P genetic distance between the specimens of Agnostrup striatus is 12.7% (COI), 13.3% (16S), and 2% (28S), which is close to the intergeneric genetic distance between Agnostrup and Nannarrup. These lower distances suggest a close genetic relationship.

Table 2.
Download as
CSV
XLSX

The list of specimens that were used in the phylogenetic analyses (the new sequences have been uploaded to GenBank).

Species Voucher Accession No. Collection Location References
16s 28s coi
Dicellophilus cf. praetermissus Tsukamoto & Eguchi, 2024 CMMI 20200913112 PP788526 PP750339 PP737183 Huanren, Liao Ning, China the present study
Proterotaiwanella tanabei Bonato, Foddai & Minelli, 2002 CMMI 20201106150 PP788520 PP750333 PP737177 Lian Yun Gang, Jiang Su, China the present study
Arrup sp. CMMI 20201107158 PP788525 PP750338 PP737182 Yan Cheng, Jiang Su, China the present study
Agnostrup striatus (Takakuwa, 1949) CMMI 20231104001D PP788521 PP750334 PP737178 Chang Zhi, Shan Xi, China the present study
CMMI 20231101001D PP788522 PP750335 PP737179 Ning Wu, Shan Xi, China the present study
CMMI 20240629001D PQ213467 – PQ222662 Ning Wu, Shan Xi, China the present study
Mecistocephalus sp. CMMI 20210409133 PP788523 PP750336 PP737180 Jing Shan, Hu Bei, China the present study
CMMI 20201022122 PP788527 PP750340 OR864655 Jian Shui, Yun Nan, China Pan et. al. (2024)
Mecistocephalus multidentatus Takakuwa, 1936 CMMI 20200121006 PP788524 PP750337 PP737181 Heng Yang, Hu Nan, China the present study
Tygarrup javanicus Attems, 1929 ZFMK-TIS-1428 DNA103936 HM453226 HM453286 KM491598 – Murienne et al. (2010)
Agnostrup oyamensis (Tsukamoto,2022) TS20210217-04 LC715630 LC715705 LC715555 Hinata, Isehara-shi, Kanagawa prefecture, Japan Tsukamoto et al. (2022)
TS20210725-02 LC715631 LC715706 LC715556 Hinata, Isehara-shi, Kanagawa prefecture, Japan Tsukamoto et al. (2022)
Agnostrup innuptus (Tsukamoto,2022) TS20220307-15 LC715484 LC715559 LC715634 Makigawa, Tsushimacho, Uwajima-shi, Ehime prefecture, Japan Tsukamoto et al. (2022)
TS20220307-16 LC715483 LC715558 LC715633 Makigawa, Tsushimacho, Uwajima-shi, Ehime prefecture, Japan Tsukamoto et al. (2022)
TS20220307-17 LC715482 LC715557 LC715632 Makigawa, Tsushimacho, Uwajima-shi, Ehime prefecture, Japan Tsukamoto et al. (2022)
Dicellophilus carniolensis (C.L. Koch, 1847) DNA102580 HM453225 HM453285 KF569305 – Murienne et al. (2010)
LBv792 – – – – Bonato et al. (2014)
Mecistocephalus guildingii Newport, 1843 DNA100809 AY288728 HM453283 AY288747 – Edgecombe and Giribet (2004); Murienne et al. (2010)
CMMI 20210321123 PP788528 PP750341 PP737184 Yuan Yang, Yun Nan, China the present study
Clinopodes flavidus Koch, 1847 PD-G7129 CHI094_Cf5 MZ427910 EU376008.1 MH816990 – Peretti et al. (2022)
Table 3.
Download as
CSV
XLSX

Mean K2P genetic distance between the genus Agnostrup and other genera of Mecistocephalidae.

Tygarrup Proterotaiwanella Nannarrup Mecistocephalus Dicellophilus Arrup
CO11 22.2% 20.5% 16.4% 18.9% 20.3% 21.9%
16S 26.9% 26.6% 18.1% 29.6% 26.8% 27.6%
28S 11.8% 12.0% 10.6% 11.7% 13.4% 10.6%

Morphological comparison of Agnostrup and Nannarrup

The genera Agnostrup and Nannarrup both belong to the subfamily Arrupinae and share the following diagnostic characters (Foddai et al. 2003): Body inconspicuously tapering backwards; leg-bearing trunk uniform in color, without dark patches; cephalic plate only slightly longer than wide; usually 2 clypeal plagulae divided by a mid-longitudinal stripe, not covering more than posterior half of clypeus; clypeal setae are mainly located in two laterally extended areas; buccae without setae; spiculum absent; internal margin of labral anterior ala reduced to a pointed end; posterior alae without longitudinal stripes; posterior margin of labral sidepiece sinuous, not fringed; coxosternum of first maxillae either divided and nonareolate or undivided and areolate, anterolateral corners virtually absent; coxosternum of second maxillae undivided or coxae connected by a membranous isthmus; groove from metameric pore and foraminal process reaching postero-external corner of coxosternum; reduced development of the telopodites of the second maxillae; forcipular tergum evidently wider than long, without a mid-longitudinal sulcus; cerrus absent; forcipular trochanteropraefemur stout, with a distal tooth only; sternal mid-longitudinal sulci not furcate; number of pairs of legs 41. Differences between these two genera include: a frontal line present in Agnostrup while absent in Nannarrup; two small clypeal plagulae covering approximately one-sixth of the clypeus in Nannarrup, whereas the clypeal plagulae of Agnostrup cover one-half to most of their clypeus; the mandible in Nannarrup is provided with four well-developed pectinate lamellae, whereas 5–6 are present in Agnostrup. In contrast to the distinctions observed among other genera within the family Mecistocephalidae, these characters are not significant enough to serve as morphological characters for delineating them as two distinct genera. (The more detailed characteristics of the species within these two genera are presented in Table 5.)

Table 4.
Download as
CSV
XLSX

Mean K2P genetic distance between the specimens of Agnostrup striatus.

Examined genus Mean distance (Standard error)
CO1 16S 28S
1. Agnostrup 13.3% (1.4%) 12.7% (1.5%) 2% (0%)
Table 5.
Download as
CSV
XLSX

Morphological comparison of six species within the genus Agnostrup are based on the description and reference pictures published by Foddai et al. 2003; Tsukamoto et al. 2022; Takakuwa and Takashima 1949; Titova 1975; Uliana et al. 2007.

Characters A. paucipes (Miyosi, 1955) A. striatus (Takakuwa,1949) A. striganovae (Titova, 1975) A. hoffmani Foddai, Bonato, Pereira & Minelli, 2003 A. innuptus Tsukamoto, 2022 A. oyamensis Tsukamoto, 2022
body length at least 20 mm 20–35 mm over 30 mm 10.3 mm 7.0–12.0 mm 8.6 mm
Clypeus: setae on the areolate part (each side) 3 5–8 4–7 7 9 6–7
Clypeus: setae on the plagulae (each side) 8 3–6 5 0 0 0
Clypeus: insulae absent present absent absent present absent
lamellae on mandible 5 5 6 4 at least 4 at least 4
second maxillae: pretarsus absent rudimentary truncate claw absent short spine short spine short spine
Forcipular segment: article I well-developed distal tooth large tooth large and blunt tooth strong pigmented basal tooth strong pigmented basal tooth strong pigmented basal tooth
Forcipular segment: article II without tooth without tooth small sharp tooth without tooth without tooth without tooth
Forcipular segment: articleIII without tooth tubercle small sharp tooth without tooth tubercle tubercle not visible
Forcipular segment: tarsungulum long basal tooth large and sharp tooth large tooth slightly pigmented basal tooth well-pigmented basal denticle well-pigmented basal denticle
Ultimate leg-bearing segment: pretarsus – small tubercle – small spine small tubercle spine

Taxonomic account

Mecistocephalidae Bollmann, 1893

Agnostrup Foddai, Bonato, Pereira & Minelli, 2003.

Agnostrup Foddai, Bonato, Pereira & Minelli, 2003: 1254.

Agnostrup: Uliana, Bonato and Minelli 2007: 24.

Nannarrup Foddai, Bonato, Pereira & Minelli, 2003, syn. nov.

Type species

Krateraspis striganovae Titova, 1975 – by original designation.

Species included

Agnostrup hoffmani (Foddai, Bonato, Pereira & Minelli, 2003), comb. nov., Agnostrup innuptus (Tsukamoto, 2022), comb. nov., Agnostrup oyamensis (Tsukamoto, 2022), comb. nov., Agnostrup paucipes (Miyosi, 1955), Agnostrup striatus (Takakuwa, 1949), and Agnostrup striganovae (Titova, 1975).

Diagnosis

Mecistocephalids with 41 leg-bearing segments; two clypeal plagulae separated by a mid-longitudinal stripe. Clypeal setae are arranged in a transversal band on the anterior part of the plagulae and on a medial part of the areolate clypeus; spiculum absent. Side-pieces of labrum are divided into anterior and posterior alae; the internal margin of each anterior ala is reduced to a point. Posterior alae with or without longitudinal stripes; posterior margin of labrum is not hairy. Mandible is provided with 4–6 pectinate lamellae. Coxosternum of the first maxillae is divided in the middle; coxosternum of the second maxillae is undivided. Telopodites terminals of the second maxillae with or without a claw. Forcipular trochanteropraefemur with one distal tooth pointing forward; forcipular articles II and III with or without teeth. Basal tooth of tarsungulum well developed. Forcipular tergum without median sulcus; sternal sulcus of trunk segments not furcate. 7–15 pores on the ventral surface of each coxopleuron; anal pores are present.

Remarks

Agnostrup differs from other genera of the Mecistocephalidae previously recorded in China due to its unusual forcipular teeth: the trochanteropraefemur with one well-developed distal tooth pointing forward and a well-developed basal tooth of the tarsungulum. Agnostrup differs from Mecistocephalus by the presence vs. absence of a pair of spicules projecting from the cephalic pleurites. It differs from Proterotaiwanella in the pattern of clypeal setae and sensilla and the finger-like processes of the labrum (Bonato et al. 2002). It differs from Dicellophilus by the latter having a labrum with longitudinal folds and fringed by marginal bristles (Bonato et al. 2010). From Tygarrup, it differs in having an entire plagula lacking a mid-longitudinal areolate strip (Chao et al. 2020). Finally, it differs from Arrup in the unusual teeth of the forcipules and the later having entire coxosternite of the first maxillae, without a mid-longitudinal suture (Foddai et al. 2003).

Agnostrup clearly resembles Nannarrup morphologically and in geographical distribution. Nannarrup was established for a single species discovered in New York, USA, and is considered to have been introduced from western America or East Asia (Foddai et al. 2003). Nearly twenty years later, Tsukamoto et al. (2022) discovered two new Nannarrup species, N. innuptus Tsukamoto, 2022, and N. oyamensis Tsukamoto, 2022, from Japan based on morphological characteristics and DNA analysis, confirming the East Asian origin of this genus. These two genera both share unique characters of forcipular article I with one well-developed distal tooth and a tarsungulum with one large basal tooth (Foddai et al. 2003; Tsukamoto et al. 2022). Comparisons of the original descriptions of Agnostrup and Nannarrup reveal several differences between these two genera, such as the presence vs. absence of a frontal line, side-pieces of the labrum fully divided into two alae vs. only incompletely subdivided into an anterior and a posterior ala, the number of setae on the clypeal plagulae, the shape of the pretarsus of the second maxillae, the tooth vs. denticle of the forcipular tarsungulum, the absence vs. presence of claws on the second maxillae, along with different numbers of mandible pectinate lamellae. However, the side-pieces of the labrum are fully divided into two alae in N. innuptus and N. oyamensis (Tsukamoto et al. 2022), and claws of the second maxillae were confirmed to be present in A. striatus after examining the new specimens collected from Shanxi province in China. The size of the teeth on the forcipular tarsungulum is also variable among species within the genus Nannarrup; the type species N. hoffmani is described as “tarsungulum with a well-developed and slightly pigmented basal tooth,” which is quite similar to the A. striatus specimen. However, in N. innuptus and N. oyamensis, this characteristic is described as “tarsungulum with a well-pigmented basal denticle.” Additionally, we compared the size of the trochanteroprefemur tooth among the three species within Nannarrup and found that N. innuptus and N. oyamensis have a distal tooth on the trochanteroprefemur that is very similar in size to that of A. striatus but significantly larger than that of N. hoffmani.

Therefore, the only definite difference between these two genera is the cephalic plate of Agnostrup, which has a frontal line, while Nannarrup lacks one. However, all three Nannarrup species have a smaller body length (ca. 10 mm) compared with the four Agnostrup species (ca. 15–30 mm). The frontal line may be absent in small mecistocephalid species. Uliana et al. (2007) also described a small Arrup species, A. lilliputianus Uliana, Bonato & Minelli, 2007, with a body length of approximately 10 mm that lacks a frontal line. Considering the low genetic distances between Nannarrup and Agnostrup and the morphologically insignificant characters for delineating them as two distinct genera, we consider Nannarrup and Agnostrup to be the same genus. Accompanied by these changes, three species previously belonging to the Nannarrup genus are transferred to Agnostrup as A. hoffmani (Foddai, Bonato, Pereira & Minelli, 2003), comb. nov., A. innuptus (Tsukamoto, 2022), comb. nov., and A. oyamensis (Tsukamoto, 2022), comb. nov.

Agnostrup striatus (Takakuwa, 1949)

Figs 3, 4

Taiwanella striata Takakuwa 1949: 51–69, fig 1.

Taiwanella striata: Wang 1996: 81–99.

Agnostrup striatus: Foddai et al. 2003: 1255.

Material examined

Neotype (this paper formally assigns): 1 male (CMMI 20231104002D), China, Shanxi Province, Changzhi, Taihang Grand Canyon; 35.9450°N, 113.4520°E; 1280 m a.s.l.; 4 Nov. 2023; coll. Tianyun Chen, Jiabo Fan & Yuan Xiong.

Non-type specimens : 1 female (CMMI 20231104001D), same data as neotype • 1 female (20240629001D), China, Shanxi Province, Ningwu County, Qingren Valley Scenic Area; 38.7980°N, 112.0365°E; 1798 m a.s.l.; 29 Jun. 2024; coll. Jiabo Fan & Yizhan Shi • 1 female (CMMI 20231101001D), China, Shanxi Province, Xinzhou, Mt. Luyashan; 38.9166°N, 112.1031°E; 1910 m a.s.l.; 1 Nov. 2023; coll. Tianyun Chen, Jiabo Fan & Yuan Xiong.

Diagnosis

An Agnostrup species with areolate part of the clypeus bearing a smooth insulae on each side. Telopodites of second maxillae with or without a rudimentary truncate claw. Forcipular article I with one large distal tooth, articles II without tooth, articles III with one acute tooth, tarsungulum with one large basal tooth.

Re-description

[The original holotype data from Takakuwa and Takashima (1949) is provided in parentheses]: Body length 20–33 mm (35 mm). Head and forcipule segment dark red in color, rest yellow.

Cephalic plate (Fig. 3A, B): Head 1.5–1.7 times as long as wide, lateral margins slightly convergent backward; frontal line slight protuberance, almost parallel; some setae and punctate depressions in the anterior of back side.

Figure 3. 

Agnostrup striatus (Takakuwa, 1949), (spm. CMMI 20231104002D). A. Cephalic plate, dorsal view; B. Clypeus, ventral view; C. Antenna, dorsal view; D. Cephalic plate, ventral view; E. Mandible; F. Maxillary complex, ventral view; G. Maxillary complex, ventral view (spm. CMMI 20231101001D). Arrowheads: a, frontal line; b, insulae; c, plagulae; d, posterior ala; e, transverse thickened line; f, clypeal areolate part; g, second maxillae coxosternite. Scale bar: 250 μm.

Antennae (Fig. 3C): with 14 articles, the distal end slightly attenuate. Setae are scattered on articles I to VII, while on the remaining articles, the setae are denser and more uniform in size.

Clypeus (Fig. 3D): Clypeal ratio about 1.2; areolate part with 5–8 (5–7) setae, an evident smooth insulae on each side, insulae bearing 2 (1) setae. clypeal plagulae with 3–4 (4–5) setae and an irregular anterior margin.

Labrum (Fig. 3D): anterior ala triangular, medial margin reduced to a vertex; posterior margin of each side-piece straight, not crenulate, and without hair-like projections.

Mandible (Fig. 3E): bearing 5 well-developed lamellae; average intermediate lamella with approximately 5 (7) teeth, all teeth of similar size.

First maxillae (Fig. 3F): coxosternite divided by mid-longitudinal, anterior corners of coxosternum not projecting; each medial projection about 1.2 times as long as wide, with 3 setae, the distal lobe clavate; telopodite about 2–2.1 times as long as wide, without seta, the distal lobe attenuated.

Second maxillae (Fig. 3F): coxosternite medially undivided, without suture; article I of the telopodite about 2.3–2.4 times as long as wide; article III about 2–2.7 times as long as wide, with several setae; telopodites tri-articulate overreaching medial projections; and telopodites of first maxillae. The pretarsus in the form of a rudimentary truncate claw.

Forcipular segment (Fig. 4A–C): The exposed part of the coxosternite is as long as it is wide. anterior margin with shallow medial concavity and with one pair of denticles. Forcipules: the length-to-width ratio of article I is greater than one with a well-developed tooth; articles II without tooth; articles III with one acute tooth; tarsungulum with a long basal tooth. Poison calyx only reaching the distal part of forcipular article I.

Figure 4. 

Agnostrup striatus (Takakuwa, 1949), (spm. CMMI 20231104002D). A. Forcipular segment, ventral view; B. Forcipular segment, dorsal view; C. A part of left forcipules, ventral view; D. Sternum of leg-bearing segment, ventral view; E. Tergite of leg-bearing segment, dorsal view; F. Ultimate leg-bearing segment, ventral view (spm. CMMI 20231104001D); G. Tergite of leg-bearing segment, dorsal view; H. Ultimate leg-bearing segment, ventral view; I. Ultimate leg-bearing segment and left leg, ventral view; J. Ultimate left leg. Arrowheads: a, forcipular tarsungulum; b, forcipular article I; c, forcipular coxosternite; d, tooth of forcipular article I; e, coxal pore; f, gonopod. Scale bar: 250 μm.

Leg-bearing segments (Fig. 4D, E): 41 leg-bearing segments; represented by very shallow mid-longitudinal thickening, anterior not furcate; no ventral glandular pores on each metasternite; the first pair of legs much smaller than the rest and the distributed bristles.

Ultimate leg-bearing segment (Fig. 4F–I): sternum sub-triangular, as long as wide; about 15 pores on each coxopleuron. Ultimate legs with or without a small apical tubercle covered with small spines.

Postpedal segments (Fig. 4F–I): The female and male gonopods are both distinct and biarticulate, with a few setae.

Remarks

The type material of the species Taiwanella striata (Takakuwa, 1949) is not available and is probably lost (Foddai et al. 2003). Similarly, Takashima (1954, 1955) conducted a survey of the centipede-type specimens existing in Japan and did not find the holotype of T. striatus, speculating that it may have been destroyed during World War II. The type locality of T. striata is an unknown locality (Japanese phonetic; it is pronounced near Cinkaiji) of Shanxi, China. We were unable to match it to any present geographical name but collected four fresh specimens morphologically matching this species from Shanxi. Therefore, we designate the specimen that most closely matches the original description as the neotype for this species.

Among these, three specimens had a noticeable rudimentary truncate claw on the telopodites of the second maxillae, while one specimen clearly lacked the claw. The claw of the second maxillae was clearly described by Takakuwa and Takashima (1949), but Foddai et al. (2003) and Uliana et al. (2007) believed that the genus Agnostrup lacks claws on the telopodites of the second maxillae. We conducted meticulous morphological examinations, genetic distance, and molecular phylogenetic analyses on these samples, confirming that they all belong to the same species. The differences in this characteristic are identified as minor morphological variations (Fig. 5).

Figure 5. 

Agnostrup striatus (Takakuwa, 1949). A. Forcipular segment, ventral view (spm. CMMI 20231104001D); B. Clypeus, ventral view (spm. CMMI 20231104001D); C. Maxillary complex, ventral view (spm. CMMI 20231101001D); D. Maxillary complex, ventral view (spm. CMMI 20231104002D). Scale bar: 250 μm.

The original description by Takakuwa and Takashima (1949) clearly indicates several smooth insulae on the clypeus, with the third segment of the forcipular article III lacking teeth. This is notably different from the specimens we found in Shanxi: the forcipular article III with one acute tooth in dorsal view, each side of the clypeus bears a smooth insulae, with two setae on each insulae.

Distribution

China (Shanxi).

Discussion

Species recognition based on morphological analysis and DNA barcoding

The genus Arrup is nested at the base of Mecistocephalidae in both ML and BI analyses (PP = 1), which is inconsistent with the findings of Bonato et al. (2003, Fig. 4). Bonato et al. (2003, Fig. 4) present an ML tree based on the number of leg-bearing segments, indicating that Arrup, Agnostrup, and Nannarrup belong to the same clade, the subfamily Arrupinae. Meanwhile, the results for Proterotaiwanella, which in our trees forms a clade with Tygarrup and Mecistocephalus (PP = 1; BS = 85%), were also inconsistent with previous morphological findings.

There are too many shared morphological characteristics between Agnostrup and Nannarrup, and the few differences, including the number of setae on the clypeal plagulae and the size of the forcipular tarsungulum, are too subtle. Compared to other genera in the family Mecistocephalidae, these characters are not significant enough to delineate them as two distinct genera. Additionally, the genetic distance between Agnostrup and Nannarrup is smaller than the distances between Agnostrup and other genera, indicating that they could also be considered the same genera genetically.

In addition to the genera Nannarrup, Agnostrup, and Arrup, Partygarrupius moiwaensis (Takakuwa, 1934) also belongs to the Arrupinae Chamberlin, 1912, and is an endemic species of Hokkaido Island, Japan. It has 41 pairs of legs, buccae without setae, and no spiculum. The coxosternum of the first maxillae is divided, while that of the second maxillae is undivided. The forcipular trochanteropraemur has only a distal tooth, and the tarsungulum has only one pointed tooth. The forcipular tergum lacks a median sulcus, and the sternal rhachides are not anteriorly furcate. Based on these similar morphological characteristics, we hypothesize that Partygarrupius moiwaensis (Takakuwa, 1934) may form a sister group with Nannarrup and Agnostrup in the phylogenetic tree. However, unlike Nannarrup and Agnostrup, it possesses an entire clypeal plagula, without a mid-longitudinal areolate stripe and extending along the lateral margins of the clypeus. This feature is similar to that of Tygarrup.

Based on morphological analysis and DNA barcoding, the genus Agnostrup now comprises six species. Detailed comparisons of species’ morphological characteristics can be found in Table 4.

Distribution of the genus Agnostrup

Most species of Arrupinae are confined to specific geographic locations, but the genus Agnostrup, with its broad distribution from Shanxi Province and northeastern China to Japan and New York, USA, exhibits a clear dispersal pattern. Specimens of Agnostrup spp., which can be as small as 1 cm, are easily transported during the movement of plants (Foddai et al. 2003). The presence of A. hoffmani in New York City is confirmed to be a result of human introduction. Another example of human-mediated introduction is Tygarrup intermedius Chamberlin, 1914, the type species of Tygarrup, originally described from British Guyana but actually taken in Washington in pots of plants imported from British Guyana (Chamberlin, 1914). Similarly, Tygarrup javanicus Attems, 1929, a centipede native to Southeast Asia and widely distributed in the Indochinese Peninsula, Java, and other regions, has been found in the Seychelles and Mauritius islands. In recent years, Tygarrup javanicus has been recorded in the Hawaiian Islands, suggesting its spread through human activity. This introduction is not unprecedented, as similar cases have been reported in Kew Gardens, London, and Vienna, Austria (Bonato et al. 2004).

The Agnostrup genus, distributed in Japan, Shanxi Province in China, and the Sikhote-Alin mountains in Russia, may indicate its adaptation to temperate and subarctic climates. Although these regions are geographically dispersed, they share similar climate zones and ecological environments, particularly forested mountainous terrain. This similarity likely provides stable habitat for the genus, enabling it to survive and thrive in these areas. The distribution of the Agnostrup genus extends from Shanxi Province and northeastern China to Japan, further demonstrating its notable geographic dispersal pattern. This wide distribution may be driven by several factors. The climate and ecological environments of Shanxi Province and northeastern China are somewhat similar to those of Japan, particularly within temperate forest ecosystems, which may offer suitable habitats for the natural dispersal of Agnostrup. Additionally, the geographic proximity between Japan and northeastern China may facilitate the dispersal of the genus through natural pathways such as wind, river basins, or cross-ocean biological dispersal.

Key to the species of Agnostrup

1 With evident smooth insulae on the clypeus 2
– Without evident smooth insulae on the clypeus 3
2 Two large clypeal plagulae covering approximately one-half of the clypeus A. striatus (Takakuwa, 1949)
– Two small clypeal plagulae covering approximately one-sixth of the clypeus A. innuptus (Tsukamoto, 2022)
3 Clypeal plagulae with additional smooth or weak areolation area along posterior part of paraclypeal sutures A. hoffmani (Foddai, Bonato, Pereira & Minelli, 2003)
– Clypeal plagulae without additional smooth or weak areolation area along posterior part of paraclypeal sutures 4
4 Telopodites of second maxillae with a short spine A. oyamensis (Tsukamoto, 2022)
– Telopodites of second maxillae without a short spine 5
5 Forcipular articles II and III with a tubercle A. striganovae (Titova, 1975)
– Forcipular articles II and III without a tubercle A. paucipes (Miyosi, 1955)

Acknowledgements

We sincerely thank Dr. Alessandro Minelli, Dr. Ivan H. Tuf, and Dr. Martin Husemann for their constructive comments and valuable suggestions on the manuscript, which have significantly contributed to improving its quality. We would like to thank Dr. Sho Tsukamoto for providing us with information about the type specimen of Arrup pauroporus (Takakuwa, 1936).

This research was supported by the National Natural Science Foundation of China (nos. 82073972 and 82204572), the key project at the central government level: The ability establishment of sustainable use for valuable Chinese medicine resources (nos. 2060302), and the CACMS Innovation Fund (CI2023E002).

References

  • Bonato L, Foddai D., Minelli A (2002) A new mecistocephalid centipede from Ryukyu Islands and a revisitation of Taiwanella (Chilopoda: Geophilomorpha: Mecistocephalidae). Zootaxa 86(1): 1–12. https://doi.org/10.11646/zootaxa.86.1.1
  • Bonato L, Foddai D, Minelli A (2003) Evolutionary trends and patterns in centipede segment number based on a cladistic analysis of Mecistocephalidae (Chilopoda: Geophilomorpha). Systematic Entomology 28(4): 539–579. https://doi.org/10.1046/j.1365-3113.2003.00217.x
  • Bonato L, Danyi L, Minelli A (2010) Morphology and phylogeny of Dicellophilus, a centipede genus with a highly disjunct distribution (Chilopoda: Mecistocephalidae). Zoological Journal of the Linnean Society 158(3): 501–532. https://doi.org/10.1111/j.1096-3642.2009.00557.x
  • Bonato L, Edgecombe GD, Zapparoli M, Minelli A (2011) Chilopoda – Taxonomic overview: Geophilomorpha. Treatise on Zoology – Anatomy, Taxonomy, Biology. The Myriapoda Volume 1: 407–443. https://doi.org/10.1163/9789004188266_002
  • Bonato L, Drago L, Murienne J (2014) Phylogeny of Geophilomorpha (Chilopoda) inferred from new morphological and molecular evidence. Cladistics 30: 485–507. https://doi.org/10.1111/cla.12060
  • Boyer SL, Giribet G (2007) A new model Gondwanan taxon: Systematics and biogeography of the harvestman family Pettalidae (Arachnida, Opiliones, Cyphophthalmi), with a taxonomic revision of genera from Australia and New Zealand. Cladistics 23(4): 337–361. https://doi.org/10.1111/j.1096-0031.2007.00149.x
  • Chamberlin RV (1914) The Stanford Expedition to Brazil, 1911. John C. Branner, Director. The Chilopoda of Brazil. Bulletin of the Museum of Comparative Zoology at Harvard College 58: 151–221.
  • Chao JL, Lee KS, Yang ZZ, Chang HW (2020) Two new species of centipedes, Tygarrup daliensis sp. nov. (Mecistocephalidae) and Australobius cangshanensis sp. nov. (Lithobiidae), from Southwestern China. Opuscula Zoologica (Budapest) 51(S2): 57–67. https://doi.org/10.18348/opzool.2020.S2.57
  • Edgecombe GD, Giribet G (2004) Adding mitochondrial sequence data (16S rRNA and cytochrome c oxidase subunit I) to the phylogeny of centipedes (Myriapoda: Chilopoda): an analysis of morphology and four molecular loci. Journal of Zoological Systematics and Evolutionary Research 42(2): 89–134. https://doi.org/10.1111/j.1439-0469.2004.00245.x
  • Edgecombe GD, Giribet G (2006) A century later – a total evidence re-evaluation of the phylogeny of scutigeromorph centipedes (Myriapoda, Chilopoda). Invertebrate Systematics 20(5): 503–525. https://doi.org/10.1071/IS05044
  • Foddai D, Bonato L, Pereira LA, Minelli A (2003) Phylogeny and systematics of the Arrupinae (Chilopoda Geophilomorpha Mecistocephalidae) with the description of a new dwarfed species. Journal of Natural History 37(10): 1247–1267. https://doi.org/10.1080/00222930210121672
  • Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35(2): 518–522. https://doi.org/10.1093/molbev/msx281
  • Joshi J, Karanth KP (2011) Cretaceous–Tertiary diversification among select scolopendrid centipedes of South India. Molecular Phylogenetics and Evolution 60(3): 287–294. https://doi.org/10.1016/j.ympev.2011.04.024
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Murienne J, Edgecombe GD, Giribet G (2010) Including secondary structure, fossils and molecular dating in the centipede tree of life. Molecular Phylogenetics and Evolution 57(1): 301–313. https://doi.org/10.1016/j.ympev.2010.06.022
  • Nguyen LT, Schmidt HA, Von HA, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Pan YY, Fan JB, Jiang C, You CX (2024) Identification of two new species of Mecistocephalus (Chilopoda, Geophilomorpha, Mecistocephalidae) from southern China and the re-description of Mecistocephalus smithii Pocock, 1895: Morphological and phylogenetic analyses.[J] ZooKeys [Accepted].
  • Peretti E, Cecchin C, Fusco G, Gregnanin L, Kos I, Bonato L (2022) Shedding light on species boundaries in small endogeic animals through an integrative approach: species delimitation in the centipede Clinopodes carinthiacus (Chilopoda: Geophilidae) in the south-eastern Alps. Zoological Journal of the Linnean Society 196(2): 902–923. https://doi.org/10.1093/zoolinnean/zlac008
  • Ronquist F, Teslenko M, Mark P, Ayres DL, Darling A, Höhna S, Larget L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Takashima H (1955) List of the myriapod type specimens existing in Japan (II). Circular of the Japanese Society of Systematic Zoology 9: 128–131. [In Japanese]
  • Titova LP (1975) Geophilids of the family Mecistocephalidae (Chilopoda) in the fauna of the USSR. Zoologicheskii Zhurnal 54(1): 39–48.
  • Tsukamoto S, Shimano S, Eguchi K (2022) Two new species of the dwarf centipede genus Nannarrup Foddai, Bonato, Pereira & Minelli, 2003 (Chilopoda, Geophilomorpha, Mecistocephalidae) from Japan. ZooKeys 1115: 117–150. https://doi.org/10.3897/zookeys.1115.83946
login to comment