Research Article |
Corresponding author: Jiao Jiang ( 149152414@qq.com ) Corresponding author: Shan Ouyang ( souyang@ncu.edu.cn ) Academic editor: Frank Köhler
© 2024 Zhong-Guang Chen, Zhe-Yu Chen, Ran-Xi Lin, Yu-Ting Dai, Xiao-Ping Wu, Jiao Jiang, Shan Ouyang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Chen Z-G, Chen Z-Y, Lin R-X, Dai Y-T, Wu X-P, Jiang J, Ouyang S (2024) A new species of Tropidauchenia Lindholm, 1924 (Gastropoda, Stylommatophora, Clausiliidae, Garnieriinae) from Guangdong, China. Zoosystematics and Evolution 100(3): 1075-1084. https://doi.org/10.3897/zse.100.130661
|
A molecular phylogenetic study was conducted on genus Tropidauchenia, based on COI and 16S sequences. A total of six out of 18 species in the genus, as well as three species of Grandinenia and eight species of subfamily Synprosphyminae and Phaedusinae were sequenced. The phylogenetic results supported the monophyly of three Clausiliid subfamilies distributed in East Asia and demonstrated that Tropidauchenia was divided into two clades that corresponded to its two main distribution areas. A new species, Tropidauchenia jiangjilini Z.-G. Chen, Z.-Y. Chen & R.-X. Lin, sp. nov., from Guangdong, southern China, has been identified and described based on morphological comparison and molecular phylogeny. The discovery expanded the distribution range of Tropidauchenia and revealed the potential species diversity of land snails in the karst region of Guangdong.
Door snails, karst landscape, phylogeny, taxonomy
Clausiliidae Gray, 1855 is a group of small to large-sized land snails with nearly global distribution (
Guangdong is situated in southern China and adjacent to Guangxi. In contrast to Guangxi, which is renowned for its karst landscape and high diversity of land snails, Guangdong is relatively understudied and lacks an understanding of its land snail fauna. Only one recently described species of Tropidauchenia, namely T. yanghaoi, has been recorded in Guangdong (
Samples were collected from Sichuan, Chongqing, Yunnan, Guangxi and Guangdong, China in 2023–2024. Living specimens were initially frozen at -20 °C for 12 hours and subsequently thawed at room temperature for 12 hours to extract the soft parts. The soft parts were then fixed in 70% ethanol. Empty shells were cleaned, dried, and preserved at 4 °C. All specimens were deposited in the School of Life Sciences, Nanchang University (Nanchang, Jiangxi, China) and the mollusc collection of Museum of Hebei University (Hebei, China). Photographs were taken by Sony® Alpha a6500 Digital Camer and edited in Adobe Photoshop CC 2015 (Adobe, San Jose, US). Maps were made in ArcGIS Pro (Esri, Redlands, US).
Genomic DNA was extracted from foot tissues preserved in 70% ethanol using a TIANamp Marine Animals DNA Kit (Tiangen Biotech, China). The quality and concentration of the DNA were checked on 1% agarose gel electrophoresis and NanoDrop 2000 (Thermo Scientific, USA). Partial cytochrome c oxidase subunit 1 (COI) and partial 16S ribosomal RNA (16S) gene segments were amplified and sequenced for molecular phylogenetic analyses. Polymerase chain reaction (PCR) systems, conditions and primer pairs are listed in Table
Primer pairs and PCR conditions used in the analyses of the COI and 16S rRNA genes.
Genes | Primer pairs | Reaction systems | Cycling conditions | Reference |
---|---|---|---|---|
COI | LCO1490: GGTCAACAAATCATAAAGATATTGG HCO2198: TAAACTTCAGGGTGACCAAAAAATCA | 12.5 μl 2× Taq Plus Master Mix II (Vazyme, Nanjing, China), 1 μl template DNA, 1 μl of each pair of primers, 9.5 μl ddH2O | 94 °C: 2 min; 94 °C: 10s, 50 °C: 60s, 72 °C: 1 min, 35 cycles; 72 °C: 10 min |
|
16S | 16SA: CGGCCGCCTGTTTATCAAAAACAT 16SB: GGAGCTCCGGTTTGAACTCAGATC | 12.5 μl 2× Taq Plus Master Mix II (Vazyme, Nanjing, China), 1 μl template DNA, 1 μl of each pair of primers, 9.5 μl ddH2O | 94 °C: 2 min; 94 °C: 10s, 50 °C: 60s, 72 °C: 1 min, 35 cycles; 72 °C: 10 min |
|
Species | Locality | CO1 | 16S | References |
---|---|---|---|---|
Tropidauchenia jiangjilini sp. nov. | Pingtang, Luoding, Guangdong, China, 22°43'26"N, 111°44'56"E | PP945861 | PP956568 | This study |
PP945862 | PP956569 | This study | ||
PP945863 | PP956570 | This study | ||
PP945864 | PP956571 | This study | ||
PP945865 | PP956572 | This study | ||
PP945866 | PP956573 | This study | ||
T. danjuan | Maan, Jiangzhou, Chongzuo, Guangxi, China (type locality), 22°27'16"N, 107°19'56"E | PP945851 | PP956558 | This study |
PP945852 | PP956559 | This study | ||
Baoan, Jiangzhou, Chongzuo, Guangxi, China, 22°17'50"N, 107°21'24"E | PP945853 | PP956560 | This study | |
PP945854 | PP956561 | This study | ||
T. parasulcicollis | Daxin, Chongzuo, China (type locality), 22°42'41"N, 107°11'55"E | PP945855 | PP956562 | This study |
PP945856 | PP956563 | This study | ||
PP945857 | PP956564 | This study | ||
PP945858 | PP956565 | This study | ||
T. cf. lucida | Chongzuo, Guangxi, China, 22°8'15"N, 106°46'41"E | PP945859 | PP956566 | This study |
PP945859 | PP956567 | This study | ||
yanghaoi | Huaiji, Zhaoqing, Guangxi, China (type locality), 23°55'18"N, 112°9'59"E | PP472620 | Unpublished | |
PP472621 | Unpublished | |||
PP472622 | Unpublished | |||
T. orientalis | Chongzuo, Guangxi, China, 22°16'29"N, 107°4'14"E | PP473359 | PP472591 | Unpublished |
PP473360 | PP472592 | Unpublished | ||
Grandinenia mirifica | Lianggu, Qintang, Guigang, Guangxi, China (type locality), 23°19'1"N, 109°14'34"E | PP473344 | PP472576 | Unpublished |
PP473345 | PP472577 | Unpublished | ||
PP473346 | PP472578 | Unpublished | ||
G. gastrum | Lianggu, Qintang, Guigang, Guangxi, China (type locality), 23°18'51"N, 109°15'49"E | PP473348 | PP472580 | Unpublished |
PP473349 | PP472581 | Unpublished | ||
PP473350 | PP472582 | Unpublished | ||
G. fuchsi | Guilin, Guangxi, China, 25°18'35"N, 110°16'19"E | PP473351 | PP472583 | Unpublished |
PP473352 | PP472584 | Unpublished | ||
PP473353 | PP472585 | Unpublished | ||
Excussispira fargesiana | Sichuan, China (type locality), 32°5'2"N, 108°3'12"E | PP945871 | PP956578 | This study |
PP945872 | PP956579 | This study | ||
PP945873 | PP956580 | This study | ||
E. lunatica | Chengkou, Chongqing, China (type locality), 31°57'34"N, 108°38'31"E | PP945867 | PP956574 | This study |
PP945868 | PP956575 | This study | ||
PP945869 | PP956576 | This study | ||
PP945870 | PP956577 | |||
Synprosphyma suilla | Honghe, Yunnan, China, 29°56'39"N, 103°02'35"E | PP945876 | PP956583 | This study |
S. basilissa | Chengdu, Sichuan, China, 30°55'26"N, 103°29'23"E | PP945874 | PP956581 | This study |
PP945875 | PP956582 | This study | ||
Miraphaedusa takagii | Guilin, Guangxi, China (type locality), 25°18'35"N, 110°16'19"E | PP945877 | PP956584 | This study |
PP945878 | PP956585 | This study | ||
Serriphaedusa zhengpingi | Yaan, Sichuan, China (type locality), 29°37'28"N, 102°53'18"E | PP945879 | PP956586 | This study |
PP945880 | PP956587 | This study | ||
Paraformosana indurata | Wushan, Chongqing, China, 31°19'2"N, 109°47'53"E | PP945881 | PP956588 | This study |
PP945882 | PP956589 | This study | ||
Cirrophaedusa plicilabris | Beibei, Chongqing, China (type locality), 30°1'47"N, 106°37'24"E | PP945883 | PP956590 | This study |
Agathylla goldi | Europe | KC756080 | KF601271 |
|
Alopia mariae | Europe | JQ911821 |
|
|
Isabellaria praestans | Europe | AY425575 |
|
Phylogenies were reconstructed by the dataset combined two genes using maximum likelihood (ML) and Bayesian inference (BI). Seventeen species of three subfamilies distributed in east Asia were included. Three species of subfamily Alopiinae Wagner, 1913 were used as outgroups for rooting the tree. ML analyses were performed in IQ-TREE v. 1.6.12 (
Abbreviations. NCU_XPWU Laboratory of Xiao-Ping Wu, Nanchang University (Nanchang, Jiangxi, China); HBUMM mollusc collection of Museum of Hebei University, Hebei, China; cp clausilium plate; il inferior lamella; lu lunella; pp principal plica; sc subcolumellar lamella; sl superior lamella; sp spiral lamella; At atrium; BC bursa copulatrix; BCD bursa copulatrix duct; D diverticulum; Ep epiphallus; P penis; PR penial retractor muscle; V vagina; VD vas deferens.
A dataset consisting of 44 COI and 47 16S sequences from 17 species, along with three outgroup taxa, was employed for phylogenetic analyses (Table
Family Clausiliidae Gray, 1855
Subfamily Garnieriinae Boettger, 1926
Clausilia bavayi Lindholm, 1924, by original designation.
Holotype. 24_NCU_XPWU_YG01, Julongdong Scenic Spot [聚龙洞风景区], Pingtang Town [苹塘镇], Luoding City [罗定市], Guangdong Province [广东省], China, 22°43'26"N, 111°44'56"E, leg. Ji-Lin Jiang, May 2024.
Paratypes. 11 specimens. 24_NCU_XPWU_YG02–09, HBUMN 10073–74, other information same as holotype; 24_NCU_XPWU_YG10, Longji village [龙吉村], Luoding City [罗定市], Guangdong Province, China, 22°44'40"N, 111°48'01"E, leg. Ji-Lin Jiang & Ran-Xi Lin, May 2024.
Shell entire (vs. decollated or fragile to almost decollated in T. bavayi, T. dorri, T. donggiaensis Nordsieck, 2002, T. giardi and T. proctostoma (Mabille, 1889)), slender-fusiform (vs. broader in T. danjuan, T. hitomiae, T. lucida, T. mengyuanensis, T. messageri (Bavay & Dautzenberg, 1899), T. nakaharai, T. napoensis, T. orientalis, T. palatalis, T. parasulcicollis and T. sulcicollis), fragile; teleoconch with very thin and dense ribs (vs. smooth in T. yanghaoi; ribs stronger but sparser in T. danjuan, T. messageri, T. orientalis, T. ootanii, T. parasulcicollis and T. sulcicollis; ribs weaker and sparser in T. hitomiae, T. lucida, T. mengyuanensis, T. nakaharai, T. napoensis and T. palatalis); aperture colored, lower part reddish-brown; penial pilasters transversal, relatively sparse, irregular zigzag.
Shell (n=12). Entire, with 10.5–11.5 whorls, hardly decollated, slender-fusiform, thin, fragile, semitranslucent, light brown, with indistinct darkish-red ribbon beneath the suture; body whorl in front of lunella darker; apical part conical to slowly attenuated. Suture shallow. Protoconch smooth with 2.5–3.0 whorls. Ribs on the teleoconch very thin and dense, extending across the whole whorl, rather evenly distributed and narrowly spaced; on the neck riblets white, broader, stronger, more widely spaced and undulate. Aperture vastly extended, oval. Peristome expanded, thickened, slightly reflected, lower part reddish-brown. Only the superior lamella visible through aperture. Superior lamella bent, fused with inferior lamella but separated with spiral lamell. The end of superior lamella longer than that of spiral lamella. Subcolumellar lamella invisible in oblique view, strong, bent, its end shorter than the end of superior lamella. Lunella invisible in oblique view, vertical. Principal plica short, initiates ventrolaterally and extending laterally, not reaching peristome. Clausilium plate invisible in oblique view, semitranslucent; overall slender; stalk thin; plate relatively broad.
Genitalia (n=4). Atrium short and relatively narrow. Penis relatively slender, almost cylindrical. Penial pilasters transversal, relatively sparse, irregular zigzag. Penial caecum strong, long, tubular. Epiphallus slender, shorter and thinner than penis. Penial retractor relatively thick and long, inserted at the middle part of penis. Vas deferens relatively slender and short. Vagina relatively slender, cylindrical. Diverticulum slender, unexpanded. Bursa copulatrix duct slender and long. Bursa copulatrix small, oval.
Genital anatomy. A. Tropidauchenia jiangjilini sp. nov., B. Penial pilasters of Tropidauchenia jiangjilini sp. nov., C. T. yanghaoi, D. Penial pilasters of T. yanghaoi. Abbreviations: At atrium; BC bursa copulatrix; BCD bursa copulatrix duct; D diverticulum; Ep epiphallus; P penis; PR penial retractor muscle; V vagina; VD vas deferens.
Measurements. Holotype: shell height 27.7 mm, width 5.0 mm; aperture height 5.6 mm, width 5.3 mm. Paratypes: shell height 23.6–28.8 mm, width 4.6–5.2 mm; aperture height 4.9–5.9 mm, width 4.6–5.2 mm (n = 11).
The species is named after Ji-Lin Jiang who first discovered the new species and assisted with the field survey.
江氏伞管螺 (Pinyin: jiāng shì sǎn guǎn luó).
Tropidauchenia jiangjilini sp. nov. is found from two adjacent hills in Luoding (Figs
Distribution of Tropidauchenia in China. Red star. Tropidauchenia jiangjilini sp. nov., orange star. T. yanghaoi, red square. T. mengyuanensis, orange square. T. ootanii, purple dot. T. napoensis, black dot. T. nakaharai, green dot. T. dorri, yellow dot. T. hitomiae, orange dot. T. lucida, brown dot. T. sulcicollis, pink dot. T. parasulcicollis, blue dot. T. danjuan, grey dot. T. orientalis.
It is possible that different environmental choices may promote the differentiation of the Clausiliidae in East Asia. Although the three subfamilies are to some extent sympatric in the region, they display different microenvironmental preferences. Phaedusinae exhibits the widest adaptability to the environment, with a preference for well-ventilated and relatively humid habitats. Synprosphyminae inhabits the extremely humid environments at relatively high altitudes. It is highly dependent on the extremely humid and low temperature, with the majority of species being found in the seepage points of groundwater or even by the river. Some species of it have evolved specialized respiration channels to facilitate survival in frequently inundated habitats. Garnieriinae is a strict rock-dwelling group and rarely descends to the ground except for spawning and dormancy. Within the subfamily, the genera Grandinenia and Tropidauchenia may demonstrate differential environmental selectivity. It has been observed that Tropidauchenia is predominantly found on the shaded, humid rock walls of dense forests, whereas Grandinenia is more commonly encountered in the more exposed and drier environment.
The placement of the new species within Tropidauchenia is supported by both morphology (inferior lamella fused with superior lamella) and molecular phylogeny. The absence of description of the genitalia, as well as the dearth of illustrations of lamellae and genitalia in the most original descriptions of Tropidauchenia species, precludes the possibility of a detailed comparison of the new species with most other congeners for these two characters. However, the distinctive shell morphology can distinguish it from all its congeners. Tropidauchenia jiangjilini sp. nov. can be easily distinguished from T. bavayi, T. dorri, T. donggiaensis, T. giardi and T. proctostoma by the protoconch solid and preserve (vs. decollated or fragile to almost decollated) and the thinner shell. Tropidauchenia jiangjilini sp. nov. is similar to T. danjuan, T. hitomiae, T. lucida, T. mengyuanensis, T. messageri, T. nakaharai, T. napoensis, T. orientalis, T. palatalis, T. parasulcicollis and T. sulcicollis in its entire shell, but differs from them by the more slender shell. It is further distinguished from T. danjuan, T. messageri, T. orientalis, T. parasulcicollis and T. sulcicollis by the weaker but denser ribs on teleoconch, from T. hitomiae, T. lucida, T. mengyuanensis, T. nakaharai, T. napoensis and T. palatalis by the stronger and denser ribs on teleoconch. Tropidauchenia jiangjilini sp. nov. is relatively similar to T. ootanii by the similar slender and ribbed shell, but differs by the weaker but denser ribs on teleoconch, the ribs’ uniform thickness and height (vs. ribs beneath the suture stronger) and the thicker and darker colored shell. The unique and distant distribution can also distinguish the new species from all the above congeners (Guangdong vs. Guangxi or Yunnan). Tropidauchenia jiangjilini sp. nov. is most similar with T. yanghaoi by the similar slender shell and the near distribution, but differs by the ribbed teleoconch (vs. smooth), the stronger and denser ribs on neck, the thinner diverticulum, the stronger penial caecum and the thinner and sparser penial pilasters. The new species and T. yanghaoi presence of a very long and strong penial caecum, while the known penial caecum in Grandinenia species are very small. For a long time, Tropidauchenia and Grandinenia can only distinguished by the lamella, the difference in penial caecum may be a diagnostic character of the two genera. However, due to the lack of information on the genitalia of most Tropidauchenia and Grandinenia species, the speculation remain further study and verification. The validity of Tropidauchenia jiangjilini sp. nov. was also supported by the molecular phylogeny. It was sistered with T. yanghaoi and forms a monophyly with the species from Guangxi.
The discovery of new species indicates that the species diversity of Garnieriinae in western Guangdong remains to be fully explored. As a group of rock-dwelling land snails, the species diversity of Garnieriinae is particularly high in the karst region. In comparison to the diverse species found in Guangxi, the known species of Garnieriinae in the karst region of Guangdong remain relatively few. Further comprehensive surveys in the future may reveal additional yet-to-be-described species.
We thank Ji-Lin Jiang (Zhaoqing), Meng-Hua Li (Sichuan Agriculture University), Chen-Yu Fei (Guangzhou) and Shi-Yang Feng (Sichuan Agriculture University) for assistance in collecting specimens, Frank Köhler for assistance in processing the manuscript, Chih-Wei Huang for reviewing the manuscript. This study was supported by the National Natural Science Foundation of China under Grant No.32360132, No.31772412, research grants from the Malacological Society of London, the Melbourne Research Scholarship for ZYC, the research project of Zhejiang Natural History Museum under Grant No.2024001 and the Biodiversity Monitoring Project of Xixi National Wetland Park of Hangzhou.