A new catfish species, Liobagrus chenhaojuni Chen, Guo & Wu, sp. nov., is described from the Tiaoxi River, a tributary of Taihu Lake, located in Zhejiang Province, China. This description is based on morphological characteristics and phylogenetic analysis. This species belongs to a group defined by the presence of a smooth posterior edge of the pectoral-fin spine and can be distinguished from other species in the group by a unique combination of characteristics, including: an upper jaw longer than the lower jaw; maxillary barbels reaching the middle of the pectoral fin; irregular blotches present on the lateral body; a rounded caudal-fin with a length ranging from 16.5% to 19.9% of the standard length; 39 to 41 post-Weberian vertebrae; and 15 to 17 anal-fin rays. The validity of this new species is further supported by the molecular phylogenetic analysis based on Cytb sequences.

catfish, phylogeny, taxonomy, Zhejiang Province

The genus Liobagrus comprises a group of small freshwater catfish endemic to East Asia. To date, 20 species have been described, with 12 of them found in mainland China: Liobagrus marginatus (Günther, 1892), Liobagrus nigricauda Regan, 1904, Liobagrus styani Regan, 1908, Liobagrus anguillicauda Nichols, 1926, Liobagrus marginatoides (Wu, 1930), Liobagrus kingi Tchang, 1935, Liobagrus aequilabris Wright & Ng, 2008, Liobagrus chenghaiensis Sun, Ren & Zhang, 2013; Liobagrus huaiheensis Chen, Wu & Wen, 2021; Liobagrus pseudostyani Chen & Guo, 2021; Liobagrus brevispina Xie, Cao & Zhang, 2022; and Liobagrus chengduensis Chen, Guo, Wu & Wen, 2022 (He 1999; Wright and Ng 2008; Sun et al. 2013; Chen and Guo 2021; Chen et al. 2021; Chen et al. 2022; Xie et al. 2022). Research on the taxonomy of Chinese Liobagrus has mainly focused on the upper and middle reaches of the Changjiang River (Yangtze) and the Huaihe River basin. However, the Liobagrus species in the lower Changjiang River have not been thoroughly surveyed or studied, potentially leaving other undescribed species undiscovered.

The Tiaoxi River is a small river situated in the western part of the Hangjiahu Plain in Zhejiang Province and is one of the main tributaries of Taihu Lake. Despite its small watershed area, the Tiaoxi River boasts a diverse fish population, with a total of 84 recorded fish species (Li and Shimatani 2016; Zhang et al. 2022). Among these species, the presence of L. styani is highly questionable, as it is believed to be narrowly distributed in the Juanshui River basin in the middle Changjiang River (Wu et al. 2013). Moreover, the L. styani recorded in the basin is not only far from its type locality but also from the distribution regions of all other Liobagrus species in China. Based on collections made between 2022 and 2024, it has been discovered that Liobagrus specimens with a smooth posterior edge of the pectoral-fin spine, distributed in the Tiaoxi River, represent an undescribed species. Here, we introduce this species as new to science. The discovery of this new taxon contributes to our understanding of the high level of fish endemism in the lower Changjiang River basin.

Specimens were manually collected from the Tiaoxi River between 2022 and 2024. Thirty-six type specimens were initially preserved in 10% formalin and subsequently transferred to 70% ethanol for long-term storage. Additionally, seven type specimens were preserved in 99% ethanol for molecular phylogenetic analyses. Vertebrae and fin rays were detected and counted using X-ray imaging. Measurements were obtained using digital calipers, with values recorded to the nearest 0.1mm.

Genomic DNA was extracted from the ventral fin of specimens preserved in 99% ethanol using the Baypure Magnetic Bead Method Animal Genomic DNA Extraction Kit (BayBio, Guangzhou, China). The quality and concentration of the DNA were checked using 1% agarose gel electrophoresis and NanoDrop 2000 (Thermo Scientific, USA). Cytb sequences were amplified using primers L14724 (GACTTGAAAAACCACCGTTG) and H15915 (CTCCGATCTCCGGATTACAAGAC). Polymerase chain reaction (PCR) amplifications of Cytb were performed in a final 25-μL volume mixture containing 1 μL of template DNA, 1 μL of each pair of primers, 12.5 μL of Green Taq Mix (Vazyme, China), and 9.5 μL ddH2O. Thermal cycling began with one cycle at 95 °C for 10 s, followed by 35 cycles of denaturation at 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min, with a final extension step at 72 °C for 10 min. PCR products were purified and sequenced using an ABI 3730XL analyzer by Sangon Biotech (China). Accession numbers of all newly obtained sequences are provided in Table 1. Sequences were aligned using MEGA v. 6.0 (Tamura et al. 2013) and manually checked. Genetic distance, based on the uncorrected p-distance model, was calculated using MEGA v. 6.0. Phylogenetic relationships were reconstructed using Bayesian inference (BI) and maximum likelihood (ML). Xiurenbagrus xiurenensis (Yue, 1981), X. gigas Zhao, Lan & Zhang, 2004, Akysis brachybarbatus Chen, 1981, Ictalurus furcatus (Valenciennes, 1840), and Noturus taylori Douglas, 1972, were used as the outgroup for rooting the tree. ML analyses were performed in IQ-TREE v. 1.6.12 (Minh et al. 2013) using the Ultrafast Fast Bootstrap approach (Minh et al. 2013) with 10,000 reiterations. The most appropriate model of sequence evolution (GTR+I+G) was selected using PartitonFinder2 v. 1.1 (Robert et al. 2017). Bayesian inference (BI) was conducted in MrBayes v. 3.2.6 (Ronquist et al. 2012). The most appropriate model of sequence evolution (GTR+I+G) was selected under ModelFinder (Subha et al. 2017). Four simultaneous runs with four independent Markov Chain Monte Carlo (MCMC) algorithms were executed for 10 million generations, and trees were sampled every 1000 generations with a burn-in of 25%. The convergence was verified with the average standard deviation of split frequencies of <0.01 and the potential scale reduction factor (PSRF) of ~1. Trees were visualized using FigTree v.1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/). Institutional abbreviations used: NCU_XPWU Laboratory of Xiao-Ping Wu, Nanchang University (Nanchang, Jiangxi, China); IHB Museum of Aquatic Organisms, Institute of Hydrobiology, Chinese Academy of Sciences (Wuhan, Hubei, China).

The placement of the new species within Liobagrus is supported by both its morphology and phylogeny. Species of Liobagrus can be divided into two groups based on the possession of a smooth or serrated posterior edge of the pectoral-fin spine. Xie et al. (2022) described L. brevispina as having a smooth posterior edge of the pectoral-fin spine. However, based on the examination of specimens, L. brevispina was found to have a serrated posterior edge of the pectoral-fin spine (Fig. 2G). The serrations on its pectoral-fin spine weaken but do not disappear as it grows. Currently, the group defined by the presence of a smooth posterior edge of the pectoral-fin spine comprises only seven species: L. reinii, L. formosanus, L. styani, L. nantoensis, L. anguillicauda, L. marginatoides, and L. aequilabris. In this group, Liobagrus chenhaojuni sp. nov. can be easily distinguished from L. aequilabris, L. formosanus, and L. marginatoides by having the upper jaw longer than the lower (vs. shorter or equal). Liobagrus chenhaojuni sp. nov. is similar to L. reinii, L. styani, L. nantoensis, and L. anguillicauda by the similar upper and lower jaw positions, but differs based on the maxillary barbels reaching the middle of the pectoral fin (vs. reaching the pectoral-fin insertion in L. reinii, L. styani, and L. nantoensis), presence of irregular blotches on the body lateral (vs. absence in L. nantoensis and L. anguillicauda), caudal-fin length is 16.5–19.9% of standard length (vs. 13.1–16.2% in L. styani and 20.3–27.0% in L. anguillicauda), 15–17 anal-fin rays (vs. 12 in L. nantoensis). Furthermore, Liobagrus chenhaojuni sp. nov. has a distinctive distribution, being exclusively found in the Tiaoxi River within the lower Changjiang River basin, far from any other congeners.

The discovery of Liobagrus chenhaojuni sp. nov., as well as Zacco tiaoxiensis in the Tiaoxi River, shows that fish diversity in this area has been underestimated. There is a need for systematic fish surveys in the basin to uncover cryptic species diversity and generate data essential for conservation efforts. Unlike most congeners distributed in streams within sparsely populated regions, the new species was found in the Yangtze River Delta region, which is the economic hub of China. Given its distribution, the new species is exposed to greater risks from human activities compared to other congeners. Therefore, it is imperative to closely monitor and protect it to ensure its survival.

We thank De-Kui He (Institute of Hydrobiology, Chinese Academy of Sciences) for his assistance in preserving type specimens and conducting x-ray imaging; Hao-Jun Chen (Linhai); Yi-Jun Li (The University of Sydney, Sichuan Agricultural University); Xin Liu (Sichuan Agricultural University); Yi Feng (Chengdu); and Wei Lei (Chengdu) for their assistance in collecting specimens. This study was supported by the National Natural Science Foundation of China under Grant Nos. 31772412 and 32360132.