Research Article |
|
Corresponding author: Daniel Cuadrado ( cuadradopm@hotmail.com ) Academic editor: Pavel Stoev
© 2024 Daniel Cuadrado, Jorge Rodríguez, Annie Machordom, Carolina Noreña, Fernando Á. Fernández-Álvarez, Pat A. Hutchings, Jane E. Williamson.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Cuadrado D, Rodríguez J, Machordom A, Noreña C, Fernández-Álvarez FÁ, Hutchings PA, Williamson JE (2024) Base-substitution rates of nuclear and mitochondrial genes for polyclad flatworms. Zoosystematics and Evolution 100(3): 863-876. https://doi.org/10.3897/zse.100.119945
|
The increase in the use of molecular methodologies in systematics has driven the necessity for a comprehensive understanding of the limitations of different genetic markers. Not every marker is optimal for all species, which has led to multiple approaches in the study of the taxonomy and phylogeny of polyclad flatworms. The present study evaluates base-substitution rates of nuclear ribosomal (18S rDNA and 28S rDNA), mitochondrial ribosomal (16S rDNA), and protein-codifying (cytb, cox1) markers for this taxonomic group, with the main objective of assessing the robustness of these different markers for phylogenetic studies. Mutation rates and Ti/Tv ratios of the other markers were assessed for the first time. We estimated substitution rates and found cytb to be the most variable, while 18S rDNA was the least variable among them. On the other hand, the transition to transversion (Ti/Tv) ratio of the different genes revealed differences between the markers, with a higher number of transitions in the nuclear gene 28S and a higher number of transversions in the mitochondrial genes. Lastly, we identified that the third codon position of the studied protein-codifying genes was highly variable and that this position was saturated in the cox1 marker but not in cytb. We conclude that it is important to assess the markers employed for different phylogenetic levels for future studies, particularly in the order Polycladida. We encourage the use of mitochondrial genes cytb and 16S for phylogenetic studies at suborder, superfamily, and family levels and species delimitation in polyclads, in addition to the well-known 28S and cox1.
Acotylea, codon, Cotylea, entropy, flatworm, molecular, purines, pyrimidines, saturation
Fast and reliable DNA sequencing has become a routinely used methodology in the description and barcoding of new species. In particular, a fragment of the mitochondrial gene cytochrome oxidase c subunit 1 (cox1) has become the most frequently used marker for molecular identification-based DNA barcoding (
To address this issue, we investigated transition bias, which involves analysing the frequency and nature of nucleotide changes between purines and pyrimidines across species genomes. This information is crucial for understanding the behaviour of different markers commonly employed in phylogenetic studies. Nucleotide changes between purines (adenine, A, and guanine, G) and pyrimidines (cytosine, C, and thymine, T) are known as transitions, whereas changes between a purine and a pyrimidine are coined transversions. Due to the disparity in the number of types of each possible nucleotide change (four types of transitions compared to eight types of transversions), the expected number of transitions relative to that of transversions (Ti/Tv ratio) would be 0.5 in DNA sequence evolution, assuming all types of nucleotide changes had equal rates of occurrence. However, Ti/Tv often exceeds 0.5 or even 1, a phenomenon known as transition bias (
Understanding relationships among closely related taxa at a species level is essential for conserving biodiversity, maintaining ecosystem functioning, and understanding macroevolutionary processes (
Flatworms (order Polycladida) are free-living, carnivorous organisms that occur in a diversity of marine habitats, with over 800 species described worldwide (
A variety of molecular markers have been used to date for the systematic analysis of polyclads. Resolution of deep nodes such as suborders (Cotylea and Acotylea) and assessment of differences in superfamilies and families have initially been based on the 28S rDNA marker (
Other polyclad studies have used a range of different molecular markers, often employing specific primers due to performance issues with universal primers, such as cox1, the 16S mitochondrial ribosomal subunit (16S rDNA), the mitochondrial cytochrome b (cytb), and the nuclear 18S rDNA (
This study evaluates the strength of support provided by cox1, 16S rRNA, and cytb mitochondrial genes, as well as the 18S rDNA and 28S rDNA nuclear genes, on the phylogeny of the Polycladida through the study of nucleotide substitutions.
Polyclad flatworms were collected from different sites along the coasts of eastern Australia, the Iberian Peninsula, the Canary Islands, Cape Verde, Costa Rica, Cyprus, and Martinique Island (Table
Flatworms were collected from under rocks in coastal environments, either by hand for intertidal and shallow individuals or using SCUBA in deeper areas, and placed in separate containers filled with seawater (specific information on species is available in the bibliography of Table
Total genomic DNA was extracted from each tissue sample using an Isolate II Genomic DNA Kit (Meridian Bioscience®) following the manufacturer’s protocol. Amplicons from two nuclear (28S rDNA, 18S rDNA) and three mitochondrial (16S rRNA, cox1, and cytb) target genes from each polyclad species were sequenced. All polymerase chain reactions (PCRs) were performed using Taq DNA polymerase (Qiagen). The reaction mix included: H2O – 10.92 μl; 10x buffer − 2 μl; 25 mM MgCl2 − 4 μl; 0.5 mM dNTP − 1 μl; 10 μM primer – 0.25 μl /primer; Taq 5 U/μl − 0.08 μl; DNA – 1.5 μl. This gave a reaction volume of 20 μl.
Sequences of approximately 1100 base pairs (bp) (28S), 800 pb (18S), 500 bp (16S), 1000 bp (cox1), and 400 bp (cytb) were amplified using the primers listed in Table
| Gene | Primer name | Sequence | Reference |
|---|---|---|---|
| 18S | 18SF2 | ACTTTGAACAAATTTGAGTGCTCA |
|
| 1800mod | GATCCTTCCGCAGGTTCACCTACG |
|
|
| 28S | Platy28S_F | AGCCCAGCACCGAATCCT |
|
| Platy28S_R | GCAAACCAAGTAGGGTGTCGC |
|
|
| 16S | PLATYS16SF1 | ACAACTGTTTATCAAAAACAT |
|
| PLATYS16SR1 | ACGCCGGTYTTAACTCAAATCA |
|
|
| cox1 | HRpra2 | AATAAGTATCATGTARACTDATRTCT |
|
| HRprb2-2 | GDGGVTTTGGDAATTGAYTAATACCTT |
|
|
| Acotylea_COI_F | ACTTTATTCTACTAATCATAAGGATATAGG |
|
|
| Acotylea_COI_R | CTTTCCTCTATAAAATGTTACTATTTGAGA |
|
|
| cytb | cytb424-444 | CAGGAAACAGCTATGACCGGWTAYGTWYTWCCWTGRGGWCARAT |
|
| cytb876-847 | TGTAAAACGACGGCCAGTGCRTAWGCRAAWARRAARTAYCAYTCWGG |
|
The PCR products were observed using TBE gel electrophoresis in 1.5% agarose gel stained with SYBER Safe and visualised under UV light. PCR products were sent to Macrogen Korea for clean-up and sequencing. Lastly, the obtained forward and reverse sequences were combined using the programme Geneious Prime 2020.2.4 (http://www.geneious.com,
The species with the highest possible number of correctly sequenced genes was selected to compare the analyses performed on the different markers. All sequences obtained in the present study have been deposited in the GenBank database under the accession numbers listed in Table
List of species and sequences studied (material from previous studies, see table list of references).
| Family | Species | 18S | 28S | 16S | cox1 | cytb | Locality | Reference |
|---|---|---|---|---|---|---|---|---|
| Discoceloidea | ||||||||
| Cryptocelidae | Cryptocelis sp. | MZ292810 | MZ292829 | MZ292858 | MZ273073 | PP856191 | Galicia, Spain |
|
| Discocelidae | Discocelis tigrina | MZ292799 | MK299370 | - | - | PP856182 |
|
|
| Leptoplanoidea | ||||||||
| Gnesiocerotidae | Echinoplana celerrima | MW376754 | MW377507 | MW376599 | MW375911 | MW392971 | New South Wales, Australia |
|
| Ceratoplana falconerae | MW376740 | MW377493 | MW376585 | MW375897 | MW392973 | Victoria, Australia |
|
|
| Parabolia megae | MW376744 | MW377497 | MW376589 | MW375901 | MW392974 | New South Wales, Australia |
|
|
| Leptoplanidae | Leptoplana sp. | - | MZ292828 | MZ292853 | MZ273072 | - | Cape Verde Island |
|
| Parviplana geronimoi | MZ292807 | - | MZ292855 | - | - | Cádiz, Spain |
|
|
| Notoplanidae | Notoplana australis | MW376750 | MW377503 | MW376595 | MW375907 | MW392986 | New South Wales, Australia |
|
| Notoplana felis | MW376753 | MW377506 | MW376598 | MW375910 | MW392985 | Victoria, Australia |
|
|
| Pleioplanidae | Pleioplana atomata | MZ292820 | MZ292832 | MZ292866 | MZ273074 | PP856198 | Asturias, Spain |
|
| Pleioplana sp. | MZ292808 | MZ292840 | MZ292856 | MZ273079 | PP856189 | Cádiz, Spain | This study | |
| Pseudostylochidae | Tripylocelis typica | MW376752 | MW377505 | MW376597 | MW375909 | MW392983 | New South Wales, Australia |
|
| Stylochoplanidae | Stylochoplana clara | MW376741 | MW377494 | MW376586 | MW375898 | MW392972 | Victoria, Australia |
|
| Stylochoidea | ||||||||
| Callioplanidae | Callioplana marginata | MW376747 | MW377500 | MW376592 | MW375904 | MW392984 | New South Wales, Australia |
|
| Neostylochus ancorus | MW376748 | MW377501 | MW376593 | MW375905 | - | New South Wales, Australia |
|
|
| Latocestidae | Eulatocestus australis | MW376749 | MW377502 | MW376594 | MW375906 | - | New South Wales, Australia |
|
| Latocestus plehni | MZ292806 | MK299376 | MZ292852 | - | PP856187 | Cape Verde Island |
|
|
| Planoceridae | Paraplanocera marginata | MW376745 | MW377498 | MW376590 | MW375902 | MW392981 | New South Wales, Australia |
|
| Paraplanocera sp. | MZ292818 | MZ292833 | MZ292868 | MZ273075 | PP856200 | Cyprus | This study | |
| Planocera edmondsi | MW376755 | MW377508 | MW376600 | MW375912 | MW392979 | Victoria, Australia |
|
|
| Planocera pellucida | MZ292797 | MK299355 | - | - | PP856180 | Canary Island, Spain |
|
|
| Idioplanidae | Idioplana australiensis | MW376746 | MW377499 | MW376591 | MW375903 | MW392980 | New South Wales, Australia |
|
| Stylochidae | Imogine fafai | MZ292817 | MZ292835 | MZ292865 | MF371138 | PP856197 | Asturias, Spain |
|
| Leptostylochus victoriensis | MW376742 | MW377495 | MW376587 | MW375899 | MW392982 | New South Wales, Australia |
|
|
| Stylochus neapolitanus | MZ292800 | MZ292841 | MZ292846 | MF371141 | PP856183 | Galicia, Spain |
|
|
| Boninioidea | ||||||||
| Boniniidae | Boninia sp. | MZ292819 | MZ292834 | MZ292869 | - | PP856201 | Costa Rica |
|
| Cestoplanidae | Cestoplana rubrocincta | MW376751 | MW377504 | MW376596 | MW375908 | MW392977 | New South Wales, Australia |
|
| Pericelidae | Pericelis beyerleyana | MZ292801 | MK299374 | MZ292847 | - | PP856184 | Martinique Island |
|
| Pericelis cata | MZ292805 | MK299352 | MZ292851 | - | - | Cape Verde Island |
|
|
| Prosthiostomoidea | ||||||||
| Prosthiostomidae | Prosthiostomum amri | MW376743 | MW377496 | MW376588 | MW375900 | MW392978 | New South Wales, Australia |
|
| Prosthiostomum siphunculus | MZ292816 | MZ292836 | MZ292864 | MZ273080 | PP856196 | Almuñécar, Spain |
|
|
| Prosthiostomum sp. | MZ292795 | MZ292826 | MZ292842 | MZ273071 | - | New South Wales, Australia | Rodriguez et al. (2021) | |
| Enchiridium magec | - | MK299349 | MZ292844 | - | PP856179 | Canary Island, Spain |
|
|
| Pseudocerotoidea | ||||||||
| Euryleptidae | Eurylepta cornuta | MZ292809 | MZ292839 | MZ292857 | MF371139 | PP856190 | Galicia, Spain |
|
| Eurylepta guayota | MZ292804 | MK299372 | MZ292850 | - | PP856186 | Martinique Island |
|
|
| Prostheceraeus roseus | MZ292811 | KY263688 | MZ292859 | MZ273078 | PP856192 | Galicia, Spain |
|
|
| Pseudocerotidae | Phrikoceros sp. | MZ292796 | MZ292827 | MZ292843 | - | PP856178 | Victoria, Australia | Rodriguez et al. (2021) |
| Pseudoceros depiliktabub | MZ292813 | MZ292837 | MZ292861 | - | PP856194 | Lizard Island, Australia |
|
|
| Pseudoceros stimpsoni | MZ292812 | MZ292838 | MZ292860 | MF371147 | PP856193 | Lizard Island, Australia |
|
|
| Pseudoceros velutinus | MZ292798 | MK299381 | MZ292845 | MZ273076 | PP856181 | Canary Island, Spain |
|
|
| Pseudoceros rawlinsonae var. galaxy | - | MK299357 | MZ292854 | - | PP856188 | Cape Verde Island |
|
|
| Pseudobiceros flowersi | MZ292814 | MZ292830 | MZ292862 | - | PP856195 | Lizard Island, Australia |
|
|
| Pseudobiceros hymanae | MZ292815 | MZ292831 | MZ292863 | - | - | Lizard Island, Australia |
|
|
| Pseudobiceros caribbensis | MZ292803 | MK299378 | MZ292849 | MZ273077 | PP856185 | Martinique Island |
|
|
| Thysanozoon alagoensis | MZ292802 | MK299383 | MZ292848 | - | - | Martinique Island |
|
|
| Thysanozoon brocchii | MW376738 | MW377491 | MW376583 | - | MW392976 | Victoria, Australia |
|
|
| Yungia aurantiaca | - | MK299386 | MZ292867 | - | PP856199 | Cádiz, Spain |
|
|
Alignments of each molecular marker were performed with the Clustal W algorithm (
A supplementary entropy analysis was also performed with IQ-TREE version 1.6.12 (
The saturation rate of the substitutions of each genetic marker was quantified through a transition (Ti) and transversion (Tv) saturation graph using PAUP* Version 4.0a (Build 166) (
Maximum likelihood (ML) analysis was performed with IQ-TREE (
Entropy analysis revealed genetic variability across the length of the obtained sequences and assessed the grade of conservation of each marker. The variable positions of each studied gene presented a continuous distribution, with substitutions unequally distributed in the nuclear genes. 18S rDNA presented 58 out of 859 (6.75% of the alignment) variable positions (37 parsimonies informative, PIs), while 28S rDNA presented 388 out of 1047 (37.0%) variable positions (306 PIs). 16S rDNA presented 322 out of 500 (64.4%) variable positions (286 PIs), while cytb presented 234 out of 393 (59.54%) variable positions (218 PIs), and cox1 presented 293 out of 521 (56.2%) variable positions (280 PIs) (Table
Genomic analysis of the studied genes. A. Entropy estimation by site: The X-axis indicates the number of sequenced positions, and the Y-axis indicates the number of variations of each position; B. Estimation of substitution rates in absolute values: The X-axis displays the pairwise genetic distance between sample pairs; the Y-axis indicates the number of mutations in absolute values; C. Estimation of Ti/Tv in pairwise sequence comparisons: The X-axis shows the pairwise genetic distance between sample pairs, and the Y-axis shows the Ti/Tv proportion; D. Estimation of transitions and transversions in pairwise sequence comparisons: The X-axis indicates the pairwise genetic distance between sample pairs, and the Y-axis indicates the proportion of transitions and transversions.
| Gene | Average distance (%) | Min distance (%) | Max distance (%) | S | Cs | PIs |
|---|---|---|---|---|---|---|
| 18S rDNA | 1.37 | 0.00 | 3.14 | 859 | 58 (6.75%) | 37 |
| 28S rDNA | 11.21 | 0.00 | 18.71 | 1047 | 388 (37.0%) | 306 |
| 16S rRNA | 22.06 | 0.28 | 32.77 | 500 | 322 (64.4%) | 286 |
| cytb | 26.86 | 0.00 | 34.40 | 393 | 234 (59.5%) | 218 |
| cox1 | 24.86 | 0.22 | 34.44 | 521 | 293 (56.2%) | 280 |
The variable sites of each codon position of the protein-codifying genes (cytb and cox1) were also assessed. The third codon position presented the highest values of interspecific maximum distances in both markers: 69.41% in cytb and 53.83% in cox1. On the other hand, the second codon position had the lowest values of maximum distances, with 16.66% in cytb and 13.42% in cox1 (Table
Genetic variability of the analysed sequences of cytb and cox1 by codon position.
| Gene | Average distance (%) | Min distance (%) | Max distance (%) |
|---|---|---|---|
| cytb first codon position | 20.38 | 0.00 | 30.58 |
| cytb second codon position | 8.88 | 0.00 | 16.66 |
| cytb third codon position | 51.71 | 0.00 | 69.41 |
| cox1 first codon position | 16.25 | 0.65 | 30.06 |
| cox1 second codon position | 5.51 | 0.00 | 13.42 |
| cox1 third codon position | 53.83 | 2.02 | 53.83 |
A total of 1485 (18S rDNA), 2556 (28S rDNA), 1653 (16S rDNA), 1176 (cytb), and 703 (cox1) pairwise comparisons from 43 (18S rDNA), 46 (28S rDNA), 45 (16S rDNA), 39 (cytb), and 30 (cox1) species were performed. Fig.
18S rDNA:
y = - 16.054x2 + 858.37x – 8E-05
R2 = 1.0000
28S rDNA:
y = - 760.97x2 + 1123.5x – 3.5153
R2 = 0.9743
16S rDNA:
y = - 114.54x2 + 462.66x – 1.4178
R2 = 0.9766
cytb:
y = 30.873x2 + 366.5x + 0.3227
R2 = 0.8436
cox1:
y = - 43.538x2 + 524.81x + 0.1409
R2 = 0.9901
The coefficient of determination (R2) was close to 1 in most cases, indicating that all values were close to a linear progression except for the cytb mitochondrial gene (R2 = 0.84).
The estimated Ti/Tv ratios plotted against the estimated sequence distances showed the Ti/Tv ratio plotted against the pairwise distance between each sample (Fig.
Congruent with the results of the Ti/Tv ratio, the initial number of transitions was higher than that of transversions for all gene markers. However, the number of transversions was greater at higher distances across all markers, as observed in the graphs, except for 28S rDNA, where transitions remained higher (Fig.
Differences among the three codon positions were evident (Fig.
Estimation of transitions and transversions for each codon position (from top to bottom: first (1), second (2), and third (3) codon positions) in cytb (A) and cox1 (B). The X-axis indicates the pairwise genetic distance between sample pairs, and the Y-axis indicates the proportion of transitions and transversions.
The matrices employed to analyse substitution ratios provided the following phylogenetic results through a maximum-likelihood analysis performed for each gene (Figs
18S rDNA (Fig.
28S rDNA (Fig.
16S rRNA (Fig.
cox1 (Fig.
cytb (Fig.
All assessed markers placed Cestoplana within or as the sister lineage of Cotylea, but none showed an unequivocal phylogenetic or kinship relationship between Cestoplana rubrocincta and the other taxa.
This study compares, for the first time, the substitutions of mitochondrial and nuclear molecular markers at the order level for polyclad flatworms, including representatives of all superfamilies within the suborders Cotylea and Acotylea.
Regarding entropy values, it is worth noting the small proportion of variable sites in the 18S rDNA nuclear gene that denote low phylogenetic values in our analyses of the order compared to 28S rDNA, which presented regions with clear variability alternating with conserved regions (Fig.
The absolute values of substitution rates observed in our research reflect a linear increase in variability in all cases. A decrease in the absolute mutation rate was only observed in cytb, which may have been caused by a certain saturation in the signal of sequence substitution due to multiple recurrent changes since more than 80% of each sequence displayed variability. This saturation trend could lead to underestimating the variation in determinate terminal taxa. Therefore, it would be more advisable to use this marker for conducting phylogenetic analyses of closer groups, such as families or superfamilies.
The Ti/Tv ratio remained relatively stable for most cases, except for 28S rDNA, which presented a higher number of transitions at all distances, and cytb, which displayed a higher number of transversions. In the case of the 28S ribosomal gene, the elevated number of transitions is most likely due to a lack of conservation of the secondary structure of the RNA molecule (
In contrast, the overall increase in transversions in mitochondrial genes, particularly in cytb, could be the accumulation of substitutions when comparing variable sequences very distant from each other. All four types of transitions, as opposed to eight types of transversions, need to be considered in such situations. Previous studies have suggested that, compared with non-synonymous transversions, non-synonymous transitions are less deleterious because they tend not to cause radical changes in amino acid physicochemical properties such as charge, polarity, and size (e.g.,
Different patterns of substitutions were also observed for the results of the 28S rDNA nuclear gene (Fig.
Conspicuous differences were observed when comparing all codon positions of each of the studied protein-codifying genes (cytb and cox1). Saturation of the transversions was observed in the third codon position of cox1. Such saturation has been reported previously for other taxonomic groups such as triclads (
Based on the results obtained in the ML analysis (Figs
28S rDNA resolved the majority of nodes well for the systematics of suborder, superfamily, family, and, in some cases, at the genus and species level in Cotylea. Nevertheless, the 28S rDNA proved less effective in resolving deep nodes within Acotylea, resulting in the formation of paraphyletic nodes.
Within the mitochondrial markers, the best resolution level (>75 bootstrap support), compared to current phylogeny (
Among the tested markers, cytb presented a higher rate of variability and did not show saturation of transitions for any codon position. Moreover, this marker presented the highest range of distances (0% to 34.40%), with an average distance of 26.86% compared to that of cox1 (highest range of distances: 0.22% to 34.44%, average distance: 24.86%).
The use of a common marker for the order Polycladida would allow direct phylogenetic comparison across studies. General primers for these mitochondrial genes often fail to hybridise, so we also recommend designing de novo cox1-specific primers for families within the suborder Cotylea and cytb-specific primers for those within Acotylea, taking into consideration third base positions. The de novo design markers will allow amplification of cox1 and cytb sequences for certain groups of polyclad flatworms that previously could not be analysed due to the high number of substitutions across the whole sequence and the lack of conserved regions.
Thus, for polyclad flatworms, we conclude that for future studies at the order level, we encourage the use of mitochondrial genes cytb and 16S rDNA and nuclear ribosomal genes 28S rDNA. We also encourage the use of the cox1 gene with the caution of analysing the third codon position to avoid errors in the analyses and resolution of deep nodes at a generic or specific level. Certainly, the most crucial aspect is to determine the specific research inquiry and taxonomic level (such as order, family, or genus) and consequently select the appropriate genes to better address the study. In the present study, we analysed five markers currently used in the resolution of phylogenies, kinship analysis, delimitation of species, etc. We look forward to future polyclad studies using our suggested approach so that we can continue advancing the systematics and origin of this taxon on a global scale. New sequencing techniques offer the possibility of incorporating additional molecular information if the selected genes accurately represent the evolutionary history of the species. Concatenating data from different suitable markers will further bolster support for the analysed clusters.
Our case study highlights the need to evaluate how well nuclear and mitochondrial genes perform within a specific taxonomic group level. We propose that the use of transition bias is a useful tool for distinguishing which markers may be more effective for any taxon and could help streamline success for future systematic studies. It would also make cross-study evaluation within a taxonomic group more effective. A more globally collaborative approach to molecular systematics would certainly facilitate the use of this approach.
We thank the Linnean Society of New South Wales for their funding via a Vickery Fund Research Grant. The authors thank the School of Natural Sciences at Macquarie University for their institutional and financial support, the Australian Museum Research Institute, and the members of the Marine Invertebrates and Malacology Departments for providing access to their facilities and laboratories and assisting in fieldwork. Thanks to Audrey Falconer, Leon Altoff, and the members of the Field Naturalists’ Club of Victoria for their assistance in collecting samples and financial support through the FNCV Environment Fund. We extend our gratitude to the members of the Marine Ecology Group from Macquarie University (Justin McNab, Louise Tosetto, Patrick Burke, and Ryan Nevatte) for their help during fieldwork. F.Á.F.-Á. was supported by a Beatriu de Pinós fellowship from the Secretaria d’Universitats i Recerca del Departament de Recerca i Universitats of the Generalitat de Catalunya (Ref. BP 2021 00035). This research was also supported by the Spanish government through the ‘Severo Ochoa Centre of Excellence’ accreditation (CEX2019-000928-S). Lastly, J.R. expresses his gratitude to the Australian Government and Macquarie University for funding his livelihood and research through the International Research Training Programme (iRTP) Scholarship.