Research Article
Print
Research Article
First occurrence of the genus Pleurobranchaea Leue, 1813 (Pleurobranchida, Nudipleura, Heterobranchia) in British waters, with the description of a new species
expand article infoMartina Turani‡, Leila Carmona§, Peter J. Barry|, Hayden L. Close|, Ross Bullimore|, Juan Lucas Cervera§
‡ University of Bergen, Bergen, Norway
§ Universidad de Cádiz, Puerto Real, Spain
| Centre for Environment Fisheries and Aquaculture Science (CEFAS), Lowestoft, United Kingdom

Corresponding author: Leila Carmona ( leila.carmona@uca.es )

Academic editor: Matthias Glaubrecht
© 2024 Martina Turani, Leila Carmona, Peter J. Barry, Hayden L. Close, Ross Bullimore, Juan Lucas Cervera.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Turani M, Carmona L, Barry PJ, Close HL, Bullimore R, Cervera JL (2024) First occurrence of the genus Pleurobranchaea Leue, 1813 (Pleurobranchida, Nudipleura, Heterobranchia) in British waters, with the description of a new species. Zoosystematics and Evolution 100(1): 49-59. https://doi.org/10.3897/zse.100.113707
ZooBank: urn:lsid:zoobank.org:pub:579ED8AF-40E7-4FE4-A8AF-ED87567D5DCC
Open Access

Abstract

In the north-eastern Atlantic and Mediterranean Sea, the pleurobranchid genus Pleurobranchaea Leue, 1813 is represented by two species, Pleurobranchaea meckeli (Blainville, 1825) and Pleurobranchaea morosa (Bergh, 1892). The former is a well-known species distributed from northern Spain to Senegal and the Mediterranean Sea, while the second is a poorly-described species. In this contribution, species delimitation analyses (ABGD and COI/16S p-distances) identified a third undescribed Pleurobranchaea species from samples collected in south-western UK waters and the Gulf of Cadiz (SW Spain). This new species, Pleurobranchaea britannica sp. nov., is also supported by several morphological synapomorphies. The British specimens constitute the first occurrence of the genus Pleurobranchaea in UK waters.

Key Words

Atlantic Ocean, Gulf of Cadiz, Mediterranean Sea, molluscan diversity, Pleurobranchaea britannica, Pleurobranchaeidae, southwest UK, systematics

Introduction

The family Pleurobranchaeidae Pilsbry, 1896 was established for heterobranchs, characterised by an oval body, broad oral veil, rolled rhinophores and variable colours. Members of this family have a bipinnate gill in the middle of the right side, which may or may not be covered by the mantle (García-Gomez and Cervera 2011). The latter character led to their inclusion together with the Umbraculida (Order Notaspidea). However, phylogenetic analyses, based on morphological and molecular data (Martynov and Schrödl 2009; Göbbeller and Klussmann-Kolb 2010), demonstrated that the Pleurobranchaeidae should be considered as a separate group. Under an alternative classification scheme, Wägele and Willan (2000) introduced the Nudipleura to unite Pleurobranchoidea and Nudibranchia. Some characteristics the Nudipleura have in common are: the loss of the shell, the presence of papillae on the notum, a hermaphroditic reproductive system with simultaneous maturation of the gametes and obligate cross-fertilisation involving copulation.

Members of the Pleurobranchaeidae are active hunters of invertebrates and typically inhabit sedimentary substrates. The family is ubiquitous and they can be found from the intertidal zone to the circalittoral. The family is considered monophyletic and comprises three genera: Pleurobranchaea Leue, 1813, Euselenops Pilsbry, 1896 and Pleurobranchella Thiele, 1925. The genus Pleurobranchaea constitutes 15 valid species (Alvim et al. 2014; MolluscaBase 2023a) that inhabit temperate or tropical waters across a wide geographical range (Muniain et al. 2007; Alvim et al. 2014). The type species of the genus, Pleurobranchaea meckeli (Blainville, 1825), is the only well-known species from European waters (Bergh 1897; Vayssière 1901; Marcus and Gosliner 1984). This species has been recorded in many localities from the Mediterranean Sea, as well as in several localities around the Atlantic Iberian coasts, Madeira, Canary Islands, Azores (Cervera et al. 2004) and Cape Verde Archipelago (Vayssière 1901). Marcus and Gosliner (1984) described two additional species of Pleurobranchaea, based on preserved material collected from Turkey, Israel (P. notmec) and Algiers (P. vayssierei). However, Cervera and Garcia-Gomez (1988), following Willan (pers. comm.), considered both names to be junior synonyms of P. meckeli. Bergh (1892) described P. morosa from a single specimen collected from the Pico-Faial Channel (Azores) at 130 m depth. No further records are attributed to this second species, since Marcus and Gosliner (1984) did not include P. morosa in their review of the Pleurobranchaeidae due to its insufficient description.

The northernmost record of Pleurobranchaea in the eastern Atlantic had been from northern Spain (Cervera et al. 2004), but recent bottom trawls conducted along the English Channel in 2018 and 2019, as well as in the Gulf of Cadiz (SW Iberian Peninsula) in 2020 collected specimens of an unknown pleurobranchid with an external appearance slightly different from Pleurobranchaea meckeli. During the surveys, the collected specimens were initially considered as a different morphotype of P. meckeli, but a detailed examination of the external and internal anatomy revealed marked differences from all other species of the genus. Subsequently, a phylogenetic analysis, based on two mitochondrial (cytochrome-oxidase subunit I and 16SrRNA) and one nuclear (Histone 3) marker, in conjunction with species delimitation analyses, supported the status of this morphotype as a new and previously undescribed species, which is formally described in the present paper.

Materials and methods

Taxon sampling and molecular data

Fourteen specimens of an undescribed species of Pleurobranchaea were collected during two different campaigns in southern England (Fig. 1A) and one in the Gulf of Cadiz (Fig. 1B). The surveys in the Western Channel and Celtic Sea occurred during the 2018 and 2019 Centre for Environment, Fisheries and Aquaculture Science (CEFAS) Quarter One South West EcoSystem (Q1SWECOS) surveys. This survey series used two commercially rigged 4 m beam trawls with 80 mm cod-end mesh, with one of the trawls fitted with a 40 mm liner to facilitate the collection of epibenthic species. The bathymetric range covered by the trawls was approximately 20–200 m. The survey conducted by the Instituto Español de Oceanografía (IEO-CSIC) in the Gulf of Cadiz, offshore between Faro and Cadiz was collected by beam trawl of 190 cm and the effective height was 60 cm above the bottom with a duration of 15 min.

Figure 1. 

Sampling stations where Pleurobranchaea britannica sp. nov. material was collected. A. The map on the left shows the south of England: the red dots refer to the 2018 campaign and the green dots to the 2019 campaign; B. The map on the right shows part of Spain and the orange dot is where samples were collected in 2019.

The material collected in these campaigns was deposited either in the Natural History Museum of London (NHM) or in the National Museum of Natural Sciences of Madrid (MNCN) (see Table 1). Twenty-four specimens of three different species (11 Pleurobranchaea meckeli, 4 P. maculata and 14 of the new species) were sequenced in this study to obtain partial sequences of two mitochondrial (cytochrome-oxidase subunit I or COI and 16SrRNA or 16S) and one nuclear (Histone 3 or H3) markers. Additionally, sequences of these genes from ten closely-related pleurobranchid taxa were added from GenBank, including two additional species of Pleurobranchaea (P. californica and P. inconspicua) and Bathydoris aioca (Er. Marcus and Ev. Marcus, 1962), Bathydoris clavigera (Thiele, 1912) and Berthella plumula (Montagu, 1803) as outgroups (Table 1).

Table 1.
Download as
CSV
XLSX

List of species used for this study including sample locality, voucher numbers and GenBank accession numbers.

Species Locality Voucher numbers GenBank accession numbers
COI 16S H3
Berthella plumula (Montagu, 1803) Ballyhenry Is., Northern Ireland, UK CASIZ 193034 MK542770 MK542742 MK542803
Prodoris clavigera Thiele, 1912 South Shetland I., Elephant I., Antartica CASIZ 167553 JX274106 JX274067 KP940463
Bathydoris aioca Er. Marcus & Ev. Marcus, 1962 California CPIC 01053 KP153283 KP153249 KP153316
Pleurobranchaea maculata Quoy & Gaimard, 1832 Auckland, New Zealand – JN675223 – –
Pleurobranchaea maculata Auckland, New Zealand – JN675222 – –
Pleurobranchaea maculata Auckland, New Zealand – JN675221 – –
Pleurobranchaea maculata Auckland, New Zealand – JN675220 – –
Pleurobranchaea californica MacFarland, 1966 California – – FJ917440 –
Pleurobranchaea inconspicua Bergh, 1897 Patagonia, Argentine, Atlantic Ocean MNCN 15.05/94846 – OR723442 OR715121
Pleurobranchaea meckeli (Blainville, 1825) Blanes, Spain, Mediterranean Sea – AY345026 – –
Pleurobranchaea meckeli Blanes, Spain, Mediterranean Sea – – – EF133470
Pleurobranchaea meckeli 005 Castellaneta Marina, Italy, Mediterranean Sea MNCN 15.05/94841 – OR723434 OR715119
Pleurobranchaea meckeli 006 Castellaneta Marina, Italy, Mediterranean Sea MNCN 15.05/94842 OR687335 OR723435 OR715118
Pleurobranchaea meckeli 008 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/94843 OR687340 OR723441 OR715116
Pleurobranchaea meckeli 010 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/94844 OR687336 OR723436 OR715117
Pleurobranchaea meckeli 016 Laayoun, Morocco, Atlantic Ocean MNCN 15.05/94845 OR687341 OR723437 –
Pleurobranchaea meckeli 21.1 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/94837 OR687337 OR723438 OR715120
Pleurobranchaea meckeli 21.2 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/94838 OR687339 OR723440 OR715115
Pleurobranchaea meckeli 21.3 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/94839 OR687338 OR723439 OR715114
Pleurobranchaea meckeli 22.1 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/94840 OR807509 – –
Pleurobranchaea britannica sp. nov. 17.1 Southwest of England NHMUK 20230086 OR687348 OR723452 OR715123
Pleurobranchaea britannica sp. nov. 17.2 Southwest of England NHMUK 20230087 OR687349 OR723446 OR715122
Pleurobranchaea britannica sp. nov. 17.3 Southwest of England NHMUK 20230085 OR687351 OR723453 OR715124
Pleurobranchaea britannica sp. nov. 17.4 Southwest of England NHMUK 20230088/1 OR687347 OR723444 OR715125
Pleurobranchaea britannica sp. nov. 18.1 Southwest of England MNCN 15.05/200180 – OR723447 –
Pleurobranchaea britannica sp. nov. 18.2 Southwest of England NHMUK 20230089 – – OR715126
Pleurobranchaea britannica sp. nov. 18.3 Southwest of England NHMUK 20230090 – – OR715127
Pleurobranchaea britannica sp. nov. 18.4 Southwest of England NHMUK 20230091 – – OR715128
Pleurobranchaea britannica sp. nov. 20.1 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/200181 OR687345 OR723448 OR715132
Pleurobranchaea britannica sp. nov. 20.2 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/200182 OR687343 OR723449 OR715133
Pleurobranchaea britannica sp. nov. 20.3 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/200183 OR687346 OR723450 OR715129
Pleurobranchaea britannica sp. nov. 20.4 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/200184 OR687342 OR723451 OR715130
Pleurobranchaea britannica sp. nov. 20.5 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/200185 OR687344 OR723445 OR715134
Pleurobranchaea britannica sp. nov. 20.6 Gulf of Cadiz, Spain, Atlantic Ocean MNCN 15.05/200186 OR687350 OR723443 OR715131

Morphological analysis

The samples were stored in 95%–100% ethanol to allow DNA extraction. Two specimens were dissected by dorsal incision. The internal morphology of the reproductive system was examined and drawn using a Leica Wild M8 dissection microscope. The buccal bulb was removed and placed in a 10% sodium hydroxide (NaOH) solution for three days until the radulae and jaws were cleaned of the surrounding tissue. The radula and jaws were then rinsed in demineralised water and rinsed at least twice with 96% ethanol before drying. Clean radulae and jaws were mounted on SEM stubs with dissection pins and coated with gold for examination with a Nova NanoSEM scanning electron microscope (SEM) at the Central Services of Scientific and Technological Research (SC-ICYT) unit of the University of Cadiz.

DNA extraction and amplification

Genomic DNA was extracted from foot tissue of specimens using the DNeasy Blood & Tissue Kits of Qiagen (Qiagen, Inc., Valencia, Ca., USA) and stored in extraction buffer at –20 °C prior to amplification. Partial sequences of H3 were amplified by polymerase chain reaction (PCR) using the universal primers H3F and H3R (Colgan et al. 2000), while universal and specific primers or their combination were used for the COI and 16S (Table 2).

Table 2.
Download as
CSV
XLSX

List of primers used for this study.

Gene Primer ID Sequence (5’to-3’) Annealing Temperature (°C) Source
COI LCO1490 (F) GGTCAACAAATCATAAAGATATTGG 50 Folmer et al. (1994)
HCO2198 (R) TAAACTTCAGGGTGACCAAAAATCA 50 Folmer et al. (1994)
Pluero26F (F) GAGTTGGGGACTTCAGGAGC 46 This study
Pluro526R (R) AATAGCCCCCGCCAATACTG 46 This study
jgLCO1490 (F) TITCIACIAAYCAYAARGAYATTGG 50 This study
jgHCO2198 (R) TAIACYTCIGGRTGICCRAARAAYCA 50 This study
16S Sar-L (F) CGCCTGTTTATCAAAAACAT 52 Palumbi (1996)
Sbr-H (R) CCGGTCTGAACTCAGATCACGT 52 Palumbi (1996)
F52 (F) ATAGCCGCGGTACTTTGACC 55 This study
R384 (R) AGTCCAACATCGAGGTCACA 55 This study
H3 H3F (F) ATGGCTCGTACCAAGCAGAGVGC 58 Colgan et al. (1998)
H3R (R) ATATCCTTRGGCATRATRGTGAC 58 Colgan et al. (1998)

Reactions took place in a total volume of 25 μl including 2 μl of template DNA, 1 μl of both forward and reverse primers (10 μM), 2.5 μl of dNTP (2 mM), a gene-dependent amount of magnesium chloride (25 mM), 0.25 μl of Qiagen DNA polymerase (5 u/μl), 5 μl of “Q-solution” (5×) and 2.5 μl of Qiagen buffer (10×; Qiagen Taq PCR Core Kit cat. no. 201225). Magnesium chloride (MgCl2) amounts were 4.5 μl for COI and 16S and 3 μl for H3. The COI fragment was amplified with initial denaturation step for 1 min at 95 °C, followed by 35 cycles of 30 s at 95 °C, an annealing step for 30 s at 52 °C (universal primer) or 50–46 °C (specific primer) and 30 s at 72 °C. A final extension step for 3 min at 72 °C was added to ensure extension. For 16S, the thermal cycle profile began with denaturation for 1 min at 95 °C, followed by 35 cycles of 30 s at 95 °C, 16 s at 52 °C (universal primer) or 16 s at 55 °C (specific primer) and 30 s at 72 °C, with a final extension step for 3 min at 72 °C. Finally, the H3 amplification was performed with an initial denaturation for 2 min at 95 °C, followed by 40 cycles of 30 s at 94 °C, an annealing step for 30 s at 58 °C and 1 min at 72 °C, with a final extension step at 72 °C for 7 min. A negative control (no template) was included in each reaction. PCR products were visualised by electrophoresis on a 2% agarose gel and those viable were purified and amplified in both directions by Macrogen Inc. All new sequences obtained were deposited in GenBank.

Nucleotide sequence alignment and phylogenetic reconstruction

All DNA chromatograms were assembled and edited using Geneious version 10.0.9 (http://www.geneious.com, Kearse et al. 2012). The sequences were aligned with MAFFT v.7.402 server (Katon and Standley 2013) using the L-INS-i iterative refinement algorithm via the CIPRES Portal Science Gateway (Miller et al. 2010). The alignments were further optimised by eye using AliView (Larsson 2014) and trimmed to 328 bp (H3), 658 bp (COI) and 450 bp (16S). These partitions were subsequently concatenated with FASconCAT-G v.1.0, resulting in 1436 bp alignment. Pairwise uncorrected p-distances between each available taxon were conducted for the COI and 16S gene using PAUP v.4.0 (Swofford 2002).

The best model of evolution was determined with jModelTest 2.1.10 (Darriba et al. 2012). The model identified with the Akaike Information Criterion (AIC) (Akaike 1998) was the Tamura-Nei model (TrN+G) for H3 and the general time-reversible model (GTR+G) for COI and 16S. Phylogenetic analyses were conducted under two optimal criteria: Maximum Likelihood (ML) and Bayesian Inference (BI). The ML phylogenetic trees were inferred using RAxML v.8.2.12 (Stamatakis 2014) under the GTRGAMMA model. Node support was assessed with rapid bootstrap analysis with 1000 replicates. Analysis stopped the search for bootstrap after 100 replicates with the autoMRE-based bootstopping criterion. Values ≥ 70% were interpreted as significant nodal support (Hillis and Bull 1993).

Bayesian Inference analyses were conducted using MrBayes v.3.2.7 (Ronquist et al. 2012). Two runs were performed in parallel with four independent MCMC chains (one heated, three cold) and default priors. The analyses were run for 5,000,000 generations, saving a tree every 1000 generations and discarding the first 1250 trees of each analysis as “burn-in.” Nodal support was estimated as posterior probabilities (PP), with values ≥ 90% taken as significant (Huelsenbeck and Rannala 2004).

Species delimitation analyses

Species delimitation analyses involved two methods: (a) the Automatic Barcode Gap Discovery (ABGD; Puillandre et al. 2012), through a simple distance matrix, based on the COI and 16S genes (generated in MEGA v.7.0.18) as input file under default intra- and interspecific priors (pmin = 0.001; pmax = 0.10) in 10 steps and with a relative gap width of 1.5; (b) a pairwise genetic distance matrix, based on the COI sequences generated in PAUP v.4.0 (Swofford 2002).

Results

Systematics

Superorder Nudipleura Wägele & Willan, 2000

Order Pleurobranchida Gray, 1827

Superfamily Pleurobranchoidea Gray, 1827

Family Pleurobranchaeidae Pilsbry, 1896

Genus Pleurobranchaea Leue, 1813

Pleurobranchaea britannica sp. nov.

https://zoobank.org/81238088-87DA-4163-81F8-06AEB3ADDCAA

Material examined

Holotype : NHMUK 20230085, 18 mm preserved length, (49°54'5.306"N, 6°45'7.056"W), southern England, 103 m depth, Apr 2019. Paratypes: NHMUK 20230087, 19 mm preserved length, (49°35'59.389"N, 4°39'48.485"W) southwest England, 91.98 m depth, Mar 2018; NHMUK 20230086, 18 mm preserved length, (49°42'13.429"N, 4°6'28.514"W) southwest England, 81.12 m depth, Mar 2018; NHMUK 20230091, 22 mm preserved length, (50°5'10.929"N, 3°41'34.436"W) southwest England, 68.94 m depth, Mar 2018; MNCN 15.05/200180, 24 mm preserved length, (50°2'41.978"N, 4°3'33.805"W) southwest England, 75.69 m depth, Mar 2018, dissected specimen; NHMUK 20230090, 18 mm preserved length, (49°54'5.306"N, 6°45'7.056"W), southwest England, 103 m depth, Apr 2019; NHMUK 20230089, 19 mm preserved length, (49°54'5.306"N, 6°45'7.056"W), southwest England, 103 m depth, Apr 2019; NHMUK 20230088/1, 20 mm preserved length, (49°54'5.306"N, 6°45'7.056"W), southwest England, 103 m depth, Apr 2019, dissected specimen; MNCN 15.05/200181, 7 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Feb 2020; MNCN 15.05/200182, 8 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Feb 2020; MNCN 15.05/200183, 11 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Feb 2020; MNCN 15.05/200184, 10 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Feb 2020; MNCN 15.05/200185, 11 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Feb 2020; MNCN 15.05/200186, 9 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Feb 2020. Additional material: MNCN 15.05/94837, 41 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Mar 2020; MNCN 15.05/94838, 43 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Mar 2020; MNCN 15.05/94839, 48 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Mar 2020; MNCN 15.05/94840, 42 mm preserved length, (36°16'19.56"N, 7°32'52.8"W) Gulf of Cadiz, 555 m depth, Mar 2020.

Diagnosis

Body oval, large, translucent with a minute cream/ochre pigmentation. Some specimens with opaque white specks irregularly spread all over mantle, oral veil, gill and posterior region of the foot not covered by the mantle. Rhinophores with dark spots on the front and white ones on the back. Gill bipinnate, with 15–18 pairs of pinnules and smooth rachis. Caudal spur absent. Outermost radular teeth bicuspid. Seminal receptacle short; bursa copulatrix at the end of the vagina and directly fused to it.

Description

External morphology (Fig. 2). Body oval and large, with a rough mantle forming irregular polygons delimited by shallow grooves (Fig. 2A, B). Base colour translucent with a minute cream to ochre pigmentation, which may not always be present. Opaque white specks might appear irregularly spread all over mantle, oral veil, gill and posterior region of the foot not covered by the mantle. Speckles density variable. Viscera partially visible through mantle in lighter individuals. Posterior part of foot round with no caudal spur (Fig. 2A). Moreover, no pedal gland was observed. Sole patterned. Anterior part of rhinophores brown and posterior covered with close white dots (Fig. 2A). Oral veil with trapezoid shape and fused with mantle where rhinophores are inserted. Veil front edge not smooth, but slightly irregular. Some specimens with series of white specks at veil corners. Gill located on the right side of the body, clearly visible and not covered by the mantle. Gill bipinnate, with 15–18 pairs of pinnules and smooth rachis. Gill with same base colour, white grains almost always present and variable in density, being visible on rachis and pinnules. Genital openings in front of gill and nephropore, clearly visible since it is covered by a circular fleshy papilla, which may have white dots. Anus opens above the 6th and 7th pinnule of the gill.

Figure 2. 

A. Living specimens of Pleurobranchaea britannica sp. nov. collected on Survey CEND 0518, southwest England. Photo by Ross Bullimore (NHMUK 20230085); B. Two young individuals of P. britannica sp. nov. from the Gulf of Cadiz, Spain (MNCN 15.05/200181; MNCN 15.05/200182); C. Specimen of P. meckeli from Morocco, Mediterranean Sea (MNCN 15.05/94845).

Internal anatomy (Figs 3, 4) Radula almost rectangular with no rachidian teeth. Radular formulae are: 35 × (53–50).0.(53–50) (NHMUK 20230088/2); 33 × (54–56).0.(54–56) (MNCN15.05/200180) (Fig. 3A). All teeth with two long and blade-shaped cusps. The outermost cusp is larger, while the one facing the centre of the radula is smaller and sometimes covered by the next tooth. Innermost teeth slightly more elongated and with finer tips, while outermost teeth with rounder tip (Fig. 3B). Jaws elongated. Anterior part of jaw elements hexagonal, hand-shaped, with 4 to 9 denticles along anterior edge. The jaw elements have a depression in the middle (Fig. 3C, D).

Figure 3. 

Pleurobranchaea britannica sp. nov. Scanning electron micrographs of radula and jaw. A. Complete radula (MNCN15.05/200180); B. Lateral teeth of radula (MNCN15.05/200180); C. View from above of the anterior part of the jaw (MNCN15.05/200180); D. Lateral view of the anterior part of the jaw (MNCN15.05/200180).

Figure 4. 

Pleurobranchaea britannica sp. nov. Reproductive system (NHMUK 20230088/5). Abbreviations: a – atrium; am – ampulla; bc – bursa copulatrix; dd – deferent duct; fg – female gland; hd – hermaphroditic duct; ov – oviduct; p – penis; pr – prostate; r – retractor muscle; ps – penis sac; sr – seminal receptacle; v – vagina.

Reproductive system (Fig. 4) begins with the hermaphroditic duct which first widens into the ampulla and thereafter narrows and divides into two parts: one entering the prostate gland and the other continuing to oviduct. The prostate gland is composed of small and pyramidal-shaped papillae. Exiting from prostate, vas deferens entering the penial sac, anchored by a retractor muscle to the inner body wall. Inside the sac, penis relatively straight, with a couple of twists, but not coiled and apparently not cuticularised. The oviduct widens slightly forming a bilobed seminal receptacle, narrowing before entering laterally into the muscular vagina. Copulatory bursa spherical, placed at the distal end of vagina. Copulatory bursa not very muscular, its wall being delicate and thinner than the vagina’s. Female gland and vagina join laterally, very close to the female orifice. There are two different genital openings: the opening closest to the nephropore is the female one, the further one is male.

Etymology

The species name in Latin refers to the British waters where this species was initially found.

Distribution

The species has been found in a number of locations in the southwest of UK waters and the Gulf of Cadiz, see Fig. 1, but we hypothesise that it could probably be distributed throughout the Atlantic coast of Spain, Portugal and France up to the southwest approaches to the English Channel.

Type locality and habitat

South-western England (see Fig. 1A). Collected from a range of depths (70–110 m) and a range of substrates that include areas of mosaic rock and mixed sediments and areas of muddier sediments.

Phylogenetic analysis

We obtained 17 sequences for COI, 20 for 16S and 21 for H3 genes. The combined data set (COI+H3+16S) provided better resolution than the COI, 16S and H3 separately. Fig. 5 shows the phylogenetic hypothesis based on the combined dataset (COI+H3+16S) constructed by Bayesian Inference (BI). The topology of the Maximum Likelihood (ML) tree was very similar to that obtained by BI (former not shown). All the sequences of the new species clustered in a single, well-supported clade (PP = 1; BS = 88), included in a broader well-supported clade (PP =1; BS = 80) together with Pleurobranchaea inconspicua, P. maculata and P. californica. All the specimens of Pleurobranchaea meckeli clustered in a different and maximum supported clade (PP =1; BS = 100) including the remaining species of Pleurobranchaea we analysed.

Figure 5. 

Phylogenetic hypothesis of Pleurobranchaea systematics, based on concatenated dataset (COI+16S+H3) inferred by Bayesian analysis. Significant support values are given as BI posterior probabilities (below branch) and ML bootstrap percentages (above branch). Rectangles are automatic barcode gap discovery for the COI and 16S dataset. White rectangles indicate the lack of those sequences in the alignment.

Uncorrected p-distances (%) between P. britannica sp. nov. and the species P. maculata and P. meckeli ranged from 12.7% to 18.3%, respectively (Table 3).

Table 3.
Download as
CSV
XLSX

Maximum and minimum COI gene pairwise uncorrected p-distances (%).

Species P. meckeli P. maculata
P. meckeli
P. maculata 16.2–17.5
P. britannica sp. nov. 16.3–18.3 12.7–13.9

The ABGD species delimitation analysis recovered three putative species, based on the COI gene with both Jukes-Cantor (JC69) and Kimura (K80) parameters, while for the 16S alignment retrieved four putative species. These differences are due to the fact that sequences of P. inconspicua and P. californica were not available for COI, whereas for 16S, there were no data for P. maculata.

Discussion

Our analyses support, from both the molecular and morphological approaches, the existence of Pleurobranchaea britannica sp. nov. as a distinct species. The geographical range of this species and that of P. meckeli partially overlap, but they can be distinguished by both external and internal characters. Externally, the new species lacks a caudal spur and has a transparent cream-coloured base with variation in the density of white spots and the mottled or “net” pattern which can be darker or lighter. Pleurobranchaea meckeli exhibits a conspicuous caudal spur and has a brown net pattern all over the body (Fig. 2A). Furthermore, the colour pattern of the rhinophores of P. britannica is characteristic with dark spots on the front and white spots on the back, respectively. Other differences between P. meckeli and P. britannica are summarised in the Appendix 1. This Appendix also includes the main differences between the known species from the Atlantic Ocean and Mediterranean Sea. For example, we also observed differences in the radula formula and the outermost teeth which are bicuspid in P. britannica, while they are unicuspid in P. meckeli. In the reproductive system, we can find several clear differences: the seminal receptacle of P. meckeli is larger than in P. britannica and, therefore, easier to observe. The bursa copulatrix in P. meckeli is not directly connected to the vagina, but with a small tube that connects the two structures. In the new species, the bursa copulatrix is located at the end of the vagina, directly connected with it. Another difference can be observed in the structure of the penis since, in P. meckeli, it performs various loops within the penal sac, while in P. britannica, it does not.

Pleurobranchaea britannica sp. nov. does not correspond to the poor descriptions of other animals currently accepted as synonyms of P. meckeli (see MolluscaBase (2023b)). For example, Pleurobranchaea dellechiaii Vérany, 1846 has a minimal external description, but the mantle has red dots even after death, which are not present in the new species. Pleurobranchaea notmec Marcus, Ev. and Gosliner 1984 has a caudal spur, absent in P. britannica and the penis is much longer (as in P. meckeli) compared to the new species. Pleurobranchaea vayssierei Marcus, Ev. and Gosliner 1984 also has a caudal spur and an elongated penis wrapped in the penal sac, but the vagina is long and quite narrow unlike P. britannica which has a wide vagina which connects the bursa copulatrix to the outside. Those last two names (P. notmac and P. vayssierei) were proposed from preserved material without any information provided of the living individuals’ colouration.

All these morphological and anatomical differences which separate P. britannica sp. nov. as a standalone species are supported by our genetic data. In fact, individuals identified as P. britannica form a single well-supported taxon (PP = 1; BS = 88), which is also separate from P. meckeli, the geographically closest species. To date, the only European (excluding the Azores) species of the genus Pleurobranchaea meckeli, has not been recorded further north than Iberian coasts. Therefore, P. britannica represents the first record of the genus Pleurobranchaea in British waters and the second valid species from European seas.

Acknowledgements

We thank the survey scientists and crew of “RV Cefas Endeavour” their help for the collection of the specimens of the new species from the English Channel. Likewise, Carlos Farias (Spanish Institute of Oceanography, IEO) donated the material of Pleurobranchaea britannica n. sp. and P. meckeli from the Gulf of Cadiz collected during several IEO oceanographic campaigns ARSA. This study has been partially supported by the project ‘Desentrañando la diversidad criptica en las regiones Lusitánica y Mediterránea: Heterobranquios marinos (Mollusca), Sílidos (Annelida) y Caprélidos (Arthropoda, Pancrustacea) como casos de estudio’ funded by the University of Cadiz (PR2018-039) to J. L. Cervera.

References

  • Akaike H (1998) Information Theory and an Extension of the Maximum Likelihood Principle. In: Parzen E, Tanabe K, Kitagawa G (Eds) Selected Papers of Hirotugu Akaike. Springer Series in Statistics. Springer, New York, NY, 199–213. https://doi.org/10.1007/978-1-4612-1694-0_15
  • Alvim J, Simone LRL, Pimenta AD (2014) Taxonomic review of the genus Pleurobranchaea (Gastropoda: Pleurobranchoidea) from Brazil, with description of a new species. The Journal of Molluscan Studies 80(5): 604–623. https://doi.org/10.1093/mollus/eyu063
  • Bergh LSR (1892) Résultats des Campagnes Scientifiques accomplies sur son yacht par Albert Ier Prince Souverain de Monaco.
  • Bergh LSR (1897) Malacologische Untersuchungen 5. In: Semper C (Ed.) Reisen im Archipel der Philippinen 7, 4 Abt. , 1 Absch., Die Pleurobranchiden 1–2. Wiesbaden Kreidel’s Verlag, 1–115.
  • Cervera JL, Garcia-Gomez JC (1988) Estudio anatomico de Pleurobranchaea meckeli Blainville, 1825 (Mollusca: Opistobranchia: Notaspidea). Arquivos do Museu Bocage 1(6): 71–90. [nova serie]
  • Cervera JL, Calado G, Gavaia C, Malaquías MAE, Templado J, Ballesteros M, García Gómez JC, Megina C (2004) An annotated and updated checklist of the opisthobranchs (Mollusca: Gastropoda) from Spain and Portugal (including islands and archipelagos). Boletín del Instituto Español de Oceanografía 20(1–4): 1–122.
  • Colgan DJ, McLauchlan A, Wilson GDF, Livingston S, Edgecombe GD, Macaranas J, Cassis G, Gray MR (1998) Histone H3 and U2 snRNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46: 419–437. https://doi.org/10.1071/ZO98048
  • Colgan DJ, Ponder WF, Eggler PE (2000) Gastropod evolutionary rates and phylogenetic relationships assessed using partial 28S rDNA and histone H3 sequences. Zoologica Scripta 29(1): 23–63. https://doi.org/10.1046/j.1463-6409.2000.00021.x
  • Darriba D, Taboada G, Doallo R, Posada D (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9(8): 772. https://doi.org/10.1038/nmeth.2109
  • Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): 294–299.
  • García-Gómez JC, Cervera JL (2011) Familia Pleurobranchidae. In: Gofas S, Moreno D, Salas C (Coords) Moluscos marinos de Andalucía. Málaga: Servicio de Publicaciones e Intercambio Científico, Universidad de Málaga, 456–459.
  • Göbbeller K, Klussmann-Kolb A (2010) Out of Antarctica? – New insights into the phylogeny and biogeography of the Pleurobranchomorpha (Mollusca, Gastropoda). Molecular Phylogenetics and Evolution 55(3): 996–1007. https://doi.org/10.1016/j.ympev.2009.11.027
  • Hillis DM, Bull JJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42(2): 182–192. https://doi.org/10.1093/sysbio/42.2.182
  • Huelsenbeck JP, Rannala B (2004) Frequentist properties of Bayesian posterior probabilities of phylogenetic trees under simple and complex substitution models. Systematic Biology 53(6): 904–913. https://doi.org/10.1080/10635150490522629
  • Katon K, Standley DM (2013) MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjies P, Drummond A (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics (Oxford, England) 28(12): 1647–1649. https://doi.org/10.1093/bioinformatics/bts199
  • Marcus EDB-R, Gosliner TM (1984) Review of the family Pleurobranchaeidae (mollusca, Opisthobranchia). Annals of the South African Museum 93(1): 1–41.
  • Martynov AV, Schrödl M (2009) The new Arctic side-gilled sea slug genus Boreoberthella (Gastropoda, Opisthobranchia): Pleurobranchoidean systematics and evolution revisited. Polar Biology 32(1): 53–70. https://doi.org/10.1007/s00300-008-0503-3
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees” in Proceedings of the Gateway Computing Environments Workshop, 1–8. https://doi.org/10.1109/GCE.2010.5676129
  • Muniain C, Ardila NE, Cervera JL (2007) Pleurobranchaea inconspicua Bergh, 1897 (Opisthobranchia: Pleurobranchidae): Redescription and distribution from Argentina and Colombia. Bonner Zoologische Beitrage 55: 291–300.
  • Palumbi SR (1996) Nucleic acids II: The polymerase chain reaction. In: Hillis DM, Moritz C, Mable BK (Eds) Molecular systematics. Sinauer Associates, Inc, 205–247.
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Swofford DL (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.0b10. Sin. Assoc.
  • Vayssière A (1901) Monographie de la famillie des Pleurobranchidés (deusiéme et derniére partie). Annales des Sciences Naturelles (Zoologie) 12: 22–75.

Appendix 1

Table A1.
Download as
CSV
XLSX

Summary of diagnostic features of species of Pleurobranchaea.

Species Radula Inner and outermost tooth Mantle and foot Caudal Spur Pedal gland Jaw (denticles on jaw elements) Rinophores Veil Gill Seminal receptacle Vagina and bursa copulatrix Penis Genital opening Distribution References
P. agassizii (Bergh, 1897) 32 x 98.0.98 Bicuspid, but 17 outermost unicuspid – Present – 4–8 – – 32 pinnules A single bulge – Muscular without cuticle – Western Atlantic: Florida, Great Bahama Bank, Gulf of Mexico Marcus and Gosliner (1984); Alvim et al. (2014)
P. bubala (Maecus and Gosliner, 1984) 35 x 100.0.100 Bicuspid, 20–30 outmost teeth unicuspid Mantle extends over the foot on both sides; pattern of dark brown pigment and irregular whitish blotches Absent Present 4–14 rarely more than 10 – A row of small tubercles 26 pinnules, smooth rachis – Long glandular vagina and bilobed bursa copulatrix The stylet is similar to that of P. tarda Protruding, with flap on hind border From Atlantic coast of Cape Península to Inhaca, Mozambique Marcus & Gosliner (1984); Alvim et al. (2014)
P. britannica sp. nov. 36 × 59– 58.0.59– 58 Bicuspid, outmost tiny secondary cusp Mantle not covering foot; translucent or cream base colour, irregular white spots Absent Absent 4–9 Rolled and pointed, are separate; the anterior part of the tip is brown and the posterior is covered with white dots Trapezoid shape and is fused with the mantle, irregular front edge 15–18 pinnules, bipinnate, smooth rachis Slightly bilobed At the distal end of muscular vagina is the spherical copulatory bursa Not cuticularised penis is relatively straight, with a couple of twists Covered by a circular fleshy papilla Atlantic coast of Spain, Portugal and France up to the English Channel
P. gela (Er. Marcus and Ev. Marcus, 1966) 42 × 57.0.57 Bicuspid, sometimes Black foot sole with light – Present 8–14 – – 18–26 pinnules Bilobed or trilobed Small, rounded bursa copulatrix Well– developed crest along cuticular translucent stylet, coiling five to six times With dorsal flap West Africa Marcus and Gosliner (1984); Alvim et al. (2014)
P. inconspicua (Bergh, 1897) 30 X 64.0.64 Bicuspid, sometime s tiny secondary cusp or unicuspid Mantle is reduced, not covering foot; translucent white, with reticulate pattern of brown lines and white dots Present Present 5–11 Smooth, translucent brown with some whitish stains, It is fused with the mantle Broad with singular row of sensory papillae along the anterior edge 20–26 pinnules, unipennate rachis Bilobed Large rounded bursa copulatrix and muscular vagina Cuticular stylet, translucent white, coiling 10–11 times; Penis large, cylindrical, sometimes projecting Surrounded by fold with triangular papilla Northern Brazil, Western Atlantic, Mediterranean, West Africa Marcus and Gosliner (1984); Muniain, Ardila, Cervera (2006); Alvim et al. (2014); WoRMS (2023)
P. meckeli (Leue, 1813) 46 × 71.0.71 Bicuspid, 1–5 outermost unicuspid Mantle is smaller than the foot; brown or dark grey crosslinked variable, background colour is cream, but sometimes there are white areas Present Present – As long as the tentacles, blunt, cylindrical Irregular front edge and with pointed ends; row of papilIae, the sides of the veil produced into a pointed cephalic tentacle with split sides 23–25 pinnules, bipinnate, alternate knobs on rachis Globular Vagina elongated and connected at the end with a round bursa copulatrix Elastic cuticular stylet with a high crest, stylet coiled 6–10 times Surrounded by thick fold Mediterranean, Atlantic, including Azores, Cape Verde Islands Marcus and Gosliner (1984); García-Gómez et al. (2011); Alvim et al. (2014)
P. morosa (Bergh, 1892) 37 × 70– 68.0.68– 70 – – – Present 5–7 – – 15 pinnules – – – – Azores Bergh (1892)
P. obesa (Verrell, 1882) 31–34×75– 90.0.75–90 Bicuspid, the outermost is unicuspid Mantle is smooth, swollen extending far out over the foot Present Present Variable number of denticles Smooth A single row of papillae 26–35 pinnules, smooth rachis Lobate and glandular Vagina and bursa copulatrix are large Cuticular stylet present – North-western Atlantic Bergh, (1892); Marcus and Gosliner (1984); Alvim et al. (2014)
P. spiroporphyra (Alvim, Simon & Pimenta, 2014) 30–32 × 40– 44.0.40–44 Bicuspid with smaller tiny cusp Mantle margin reduced, not covering foot, mantle with tiny flap at end of gill Present Present 1–5 Rolled, separated Broad, thin, connected to head region; deep notch in apical third or quarter of oral tentacles; several large rounded papillae forming one row 17–23 pinnules, unipinnate, tuberculated rachis Many enlargements – Penis large, cylindrical; cuticular stylet with 12–14 coils Surrounded by thick fold, with triangular papillae Rio de Janeiro Alvim et al .(2014); WoRMS (2023)
P. tarda (Verrill, 1880) 70.0.70 Bicuspid, six outermost unicuspid Smooth mantle and about the same size as foot Sometime there is a short spur Present 5–7 Typical for the genus Tubercles 20–30 pinnules, Tuberculate d Ciliated and serial Vagina is short and wide Cuticular stylet present With or without flap Western and south-eastern Atlantic: from Martha’s Vineyard to south of Cuba; from Angola to Agulhas Bank Vayssiere (1901); Marcus and Gosliner (1984); Alvim et al. (2014)
login to comment