Research Article
Print
Research Article
A new species of free-living marine nematode, Fotolaimus cavus sp. nov. (Nematoda, Oncholaimida, Oncholaimidae), isolated from a submarine anchialine cave in the Ryukyu Islands, southwestern Japan
expand article infoDaisuke Shimada‡§, Keiichi Kakui‡, Yoshihisa Fujita|
‡ Hokkaido University, Sapporo, Japan
§ National Museum of Nature and Science, Tsukuba, Japan
| Okinawa Prefectural University of Arts, Naha, Japan

Corresponding author: Daisuke Shimada ( oncholaimus@gmail.com )

Academic editor: Pavel Stoev
© 2023 Daisuke Shimada, Keiichi Kakui, Yoshihisa Fujita.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Shimada D, Kakui K, Fujita Y (2023) A new species of free-living marine nematode, Fotolaimus cavus sp. nov. (Nematoda, Oncholaimida, Oncholaimidae), isolated from a submarine anchialine cave in the Ryukyu Islands, southwestern Japan. Zoosystematics and Evolution 99(2): 519-533. https://doi.org/10.3897/zse.99.109097
ZooBank: urn:lsid:zoobank.org:pub:75589A9A-94C3-4F20-BBEC-A4C7D3799836
Open Access

Abstract

Fotolaimus cavus sp. nov. was described from a submarine anchialine cave called Akuma-no-yakata on the Shimoji Island, Miyako Island Group, Ryukyu Islands, southwestern Japan. This is the first free-living marine nematode isolated from a submarine cave in Japan, and the third species of the genus Fotolaimus. This new species differs from its congeners by its small body size, wide amphids, long buccal cavity, long conico-cylindrical tail, and proximally curved gubernaculum. We provide amended dichotomous keys to genera in the subfamily Oncholaiminae and species in Fotolaimus. We also analyzed partial DNA sequences encoding ribosomal small subunit RNA and cytochrome c oxidase subunit I from Fotolaimus cavus sp. nov. and six other species of Oncholaimidae collected from Japanese waters. The phylogenetic tree based on the ribosomal small subunit RNA sequences using maximum likelihood analysis suggested a close relationship between Fotolaimus and Wiesoncholaimus as well as Oncholaimus. The topology of the tree was similar to those from previous studies; however, it suggested a new phylogenetic position of Adoncholaimus as a sister clade for Viscosia and Oncholaimus.

Key Words

cave scuba diving, Enoplea, meiofauna, Miyako Island Group, molecular phylogeny, Oncholaiminae

Introduction

Free-living nematodes are the most abundant taxon in the marine environment and the dominant organisms in the meiobenthos of submarine caves, including anchialine caves (D’Addabbo et al. 2008; Arunimaand and Mohan 2021). However, surveys of meiofauna, including nematodes, in submarine caves have only been conducted in the Canary Islands (García-Valdecasas Huelín 1985; Riera et al. 2018), Hong Kong (Zhou and Zhang 2003, 2008), Italy (Wieser 1954; Ape et al. 2015; Onorato and Belmonte 2017), and Cuba (Pérez-García et al. 2018). Thus, our taxonomic and ecological knowledge of nematodes from submarine caves is insufficient. In the present study, we describe a new species of the free-living marine nematode genus Fotolaimus Belogurova & Belogurov, 1974 collected from an anchialine cave called Akuma-no-yakata (= Devil’s Palace) and located on the Shimoji Island (or Shimojijima Island), Miyako Island Group, Ryukyu Islands, southwestern Japan. Osawa and Fujita (2019) have provided a detailed description of this cave, and faunal surveys conducted in Akuma-no-yakata in recent years identified the following organisms in the cave: crustaceans (Fujita et al. 2013, 2017; Anker and Fujita 2014; Osawa and Fujita 2016, 2019; Kakui and Fujita 2018, 2020; Saito and Fujita 2022), ophiuroids (Okanishi and Fujita 2018, 2019), annelids (Worsaae et al. 2021), molluscs (Mizuyama et al. 2022), sponges (Ise et al. 2023), and pycnogonids (Kakui and Fujita 2023).

Belogurova and Belogurov (1974) established the genus Fotolaimus in Oncholaimidae Filipjev, 1916. Currently, this genus contains two species, i.e., F. marinus Belogurova & Belogurov, 1974 (type species) and F. apostematus (Wieser, 1959) Belogurova & Belogurov, 1974. Fotolaimus belongs to the subfamily Oncholaiminae Filipjev, 1916, based on its left ventrosublateral tooth being larger than the other two teeth and the presence of a prodelphic ovary. Members of Fotolaimus resemble those of Metoncholaimus Filipjev, 1918 as males have a gubernaculum and females have a Demanian system, but differ from the Metoncholaimus species by the presence of ten or more terminal ducts and pores (whereas Metoncholaimus members have two ducts and two pores) (Belogurova and Belogurov 1974; Belogurov and Belogurova 1988; Smol et al. 2014). However, there are currently no molecular data supporting the phylogenetic position of Fotolaimus.

In a recent classification system by Hodda (2022), the family Oncholaimidae belongs to the order Oncholaimida Siddiqi, 1983 = suborder Oncholaimina De Coninck, 1965 = superfamily Oncholaimoidea Filipjev, 1916 with two other families, i.e., Enchelidiidae Filipjev, 1918 and Thalassogeneridae Orton Williams & Jairajpuri, 1984. Thalassogeneridae is a terrestrial family that includes only the type genus Thalassogenus Andrássy, 1973, and several authors do not include Thalassogeneridae in Oncholaimoidea based on morphological data (Jensen 1976; Lorenzen 1981). Since molecular data do not allow any conclusion, only Oncholaimidae and Enchelidiidae are considered members of Oncholaimoidea sensu stricto. Several molecular phylogenetic analyses strongly support the monophyly of the clade composed of Oncholaimoidea sensu stricto (Meldal et al. 2007; van Megen et al. 2009; Bik et al. 2010a, b; Pereira et al. 2010; Smythe 2015; Smythe et al. 2019; Ahmed et al. 2022). However, analyses of ribosomal small subunit RNA sequences (Meldal et al. 2007; Bik et al. 2010a, b; Smythe 2015) and whole-genome/transcriptome (Smythe et al. 2019; Ahmed et al. 2022) do not support monophyly of Oncholaimidae. The monophyly of the seven subfamilies comprising Oncholaimidae (for three of which there are no molecular data) is also not supported by molecular analyses (Bik et al. 2010a, b; Smythe 2015), and phylogenetic relationships within Oncholaimoidea that have been supported by morphological analyses (e.g., Smol et al. 2014; Hodda 2022) are considered to require significant revision.

Materials and methods

Sampling and morphological observation

Sediment samples were collected by scuba diving from a completely dark, anchialine zone at 7–20 m depth (“second slope zone,” Osawa and Fujita 2019) in the submarine cave Akuma-no-yakata, Shimoji Island, Miyako Island Group, Ryukyu Islands, southwestern Japan (24°49'22.5"N, 125°08'07.8"E) on 26 Oct. 2018. Thirteen nematode individuals were isolated from the sediments and preserved in DESS solution (Yoder et al. 2006). We considered that these individuals belonged to the same species in the family Oncholaimidae. Three males and four females were permanently mounted in anhydrous glycerin (Shimada et al. 2021), observed using a BX51 light microscope (Olympus, Japan) with differential interference contrast, and photographed with an PCM500 digital camera (AS ONE, Japan). One male and one female were dried using the hexamethyldisilazane method (Nation 1983), sputter-coated with gold to a thickness of 20 nm, and observed using an S-3000N scanning electron microscope (SEM; Hitachi, Japan). We edited digital photographs using GIMP ver. 2.10 (https://www.gimp.org) and generated measurements and drawings from digital photographs using Inkscape ver. 1.0 (https://inkscape.org). We deposited all specimens examined in the Invertebrate Collection of Hokkaido University Museum (ICHUM). The terminology used to describe the arrangement of morphological features such as setae follows that of Decraemer et al. (2014). The following de Man’s ratios (Hooper 1986) were used: a, ratio of body length to maximum body diameter; b, ratio of body length to pharyngeal length; c, ratio of body length to tail length; c’, ratio of tail length to body diameter at cloacal opening or anus; and V, position of vulva from anterior body end expressed as percentage of body length.

Molecular experiments

Two males and two females isolated from the Akuma-no-yakata cave were used. Additionally, we included 18 individuals of six oncholaimid species from Japanese waters, i.e., Oncholaimus secundicollis Shimada, Kajihara, & Mawatari, 2009, Oncholaimus cf. oxyuris Ditlevsen, 1911, Oncholaimus cf. vesicarius (Wieser, 1959), Wiesoncholaimus jambio Shimada & Kakui, 2021, Adoncholaimus daikokuensis Shimada & Kajihara, 2014, and Adoncholaimus pseudofervidus Shimada & Kajihara, 2014, for phylogenetic analysis (Table 1). Total DNA was extracted using an ISOHAIR extraction kit (NIPPON GENE, Japan) following the protocols described by Tanaka et al. (2012) and Iwahori (2014) with minor modifications. Each nematode was placed in 20 μL dissolving solution containing 18.5 μL 1% extraction buffer in TE buffer pH 8.0, 0.5 μL lysis solution, and 1.0 μL enzyme solution and incubated at 55 °C for 60 min (extraction buffer, lysis solution, and enzyme solution are included in the kit). Nearly full-length sequences encoding ribosomal small subunit RNA (18S) and mitochondrial cytochrome c oxidase subunit I (COI) were amplified by PCR using KOD One PCR Master Mix (TOYOBO, Japan). PCR primers for 18S amplification were as follows: forward EukA (AACCTGGTTGATCCTGCCAGT) (Díez et al. 2001) and reverse 26R (CATTCTTGGCAAATGCTTTCG), forward 9FX (AAGTCTGGTGCCAGCAGCCGC) and reverse 13R (GGGCATCACAGACCTGTTA), and forward 2FX (GGAAGGGCACCACCAGGAGTGG) and reverse 18P (TGATCCWKCYGCAGGTTCAC) (De Ley et al. 2002). PCR primers for COI amplification were forward F1 (CCTACTATGATTGGTGGTTTTGGTAATTG) and reverse R2 (GTAGCAGCAGTAAAATAAGCACG) (Kanzaki and Futai 2002) and forward JB3 (TTTTTTGGGCATCCTGAGGTTTAT) and reverse JB5 (AGCACCTAAACTTAAAACATAATGAAAATG) (Derycke et al. 2005). The thermal cycling program consisted of 35 cycles at 98 °C for 10 s, 50 °C for 5 s, and 68 °C for 10 s. We determined the nucleotide sequences by direct sequencing using a BigDye Terminator Kit ver.3.1 (Applied Biosystems, USA) with a 3730 Genetic Analyzer (Applied Biosystems). Fragments were joined into a single sequence using MEGA X (Kumar et al. 2018). We deposited the obtained sequences (Table 1) in the International Nucleotide Sequence Database (INSD) through the DNA Data Bank of Japan.

Table 1.
Download as
CSV
XLSX

List of nematodes sequenced from Japanese waters with INSD accession numbers. *Type locality.

Species N Date Locality Accession numbers
18S COI
Fotolaimus cavus sp. nov. 4 26 Oct. 2018 Akuma-no-yakata LC746839–LC746842 LC746861–LC746864
Wiesoncholaimus jambio 4 25 Jun. 2015 *off Misaki, Sagami Bay LC746843–LC746846 LC759639–LC759641
Oncholaimus secundicollis 2 13 Jul. 2014 *Akkeshi, Hokkaido LC746847, LC746848 –
Oncholaimus cf. oxyuris 5 23 Jun. 2013 Hamanaka, Hokkaido LC746849, LC746850 LC746865–LC746869
Oncholaimus cf. vesicarius 18 17 Mar. 2015 Akkeshi, Hokkaido LC746851, LC746852 LC746870–LC746887
Adoncholaimus daikokuensis 4 19 Jun. 2012 *Daikoku Island, Hokkaido LC746853–LC746856 LC746888–LC746891
Adoncholaimus pseudofervidus 4 20 May 2012 *Mukawa, Hokkaido LC746857–LC746860 LC746892–LC746895

Phylogenetic analysis

The 18S dataset (1442 bp long after alignment) used for phylogenetic analysis included 21 oncholaimid sequences obtained in the present study, and 38 oncholaimid sequences, 12 enchelidiid sequences, and three outgroup sequences (Enoplus Dujardin, 1845 and Enoploides Ssaweljev, 1912) obtained from the INSD (Table 2). All sequences were aligned according to the secondary structure predicted using RNAfold WebServer (Gruber et al. 2008; Lorenz et al. 2011). Sequences were trimmed in MEGA X and alignment-ambiguous sites were then removed using Gblocks ver. 0.91b (Castresana 2000) in NGPhylogeny.fr (Lemoine et al. 2019) and the “relaxed” parameters described in Talavera and Castresana (2007). The optimal substitution model was GTR+F+R3, determined under the corrected Akaike information criterion option in ModelFinder (Kalyaanamoorthy et al. 2017). A maximum likelihood (ML) analysis was constructed based on the 18S dataset using IQ-TREE ver. 2.1.2 (Minh et al. 2020) under the ‘bnni’ option (Hoang et al. 2018). Clade support was estimated using 1,000 replicates for both SH-like approximate likelihood ratio tests (SH-aLRT; Guindon et al. 2010) and ultrafast bootstraps (UFBoot; Hoang et al. 2018) as a function of IQ-TREE. The ML tree was drawn using FigTree ver. 1.4.4 (http://tree.bio.ed.ac.uk) and processed using Illustrator CS6 (Adobe, USA).

Table 2.
Download as
CSV
XLSX

List of nematode sequences from the INSD including the phylogenetic analysis. Abbreviations: A = Atlantic Ocean side; FS = French Southern and Antarctic Lands; nd = no data; P = Pacific Ocean side. *Outgroup.

Family Subfamily Species Accession number Reference
Oncholaimidae Oncholaiminae Oncholaimus sp. AUK23 UK HM564402 Bik et al. (2010b)
Oncholaimus sp. AUK35 UK HM564474 Bik et al. (2010b)
Oncholaimus sp. AUK36 UK HM564475 Bik et al. (2010b)
Oncholaimus sp. BUS1 USA (A) HM564404 Bik et al. (2010b)
Oncholaimus sp. BUS4 USA (A) HM564409 Bik et al. (2010b)
Oncholaimus sp. BUS5 USA (A) HM564410 Bik et al. (2010b)
Oncholaimus sp. BUS7 USA (A) HM564411 Bik et al. (2010b)
Oncholaimus sp. NAR4 USA (A) HM564429 Bik et al. (2010b)
Oncholaimus sp. NAR7 USA (A) HM564432 Bik et al. (2010b)
Oncholaimus sp. NAR16 USA (A) HM564426 Bik et al. (2010b)
Oncholaimus sp. NUS2 USA (A) HM564438 Bik et al. (2010b)
Oncholaimus sp. NUS5 USA (A) HM564444 Bik et al. (2010b)
Oncholaimus sp. NUS6 USA (A) HM564445 Bik et al. (2010b)
Oncholaimus sp. NUS7 USA (A) HM564446 Bik et al. (2010b)
Oncholaimus sp. OUS2 USA (A) HM564450 Bik et al. (2010b)
Oncholaimus sp. SBA2 South Africa HM564592 Bik et al. (2010b)
Oncholaimus sp. SBA3 South Africa HM564593 Bik et al. (2010b)
Oncholaimus sp. SBA5 South Africa HM564594 Bik et al. (2010b)
Oncholaimus sp. AS479 Japan KR265044 Smythe (2015)
Oncholaimus sp. DS-2015 Japan LC093124 Shimada (unpubl.)
Pseudoncholaimus sp. AS89 USA (A) KR265048 Smythe (2015)
Adoncholaiminae Adoncholaimus sp. nd AF036642 Mullin et al. (2005)
Oncholaimellinae Viscosia sp. AUK10 UK HM564399 Bik et al. (2010b)
Viscosia sp. HCL9 UK HM564570 Bik et al. (2010b)
Viscosia sp. HCL10 UK HM564557 Bik et al. (2010b)
Viscosia sp. HCL11 UK HM564558 Bik et al. (2010b)
Viscosia sp. HCL15 UK HM564560 Bik et al. (2010b)
Viscosia sp. HCL24 UK HM564565 Bik et al. (2010b)
Viscosia sp. HCL27 UK HM564566 Bik et al. (2010b)
Viscosia sp. LUK1 UK HM564417 Bik et al. (2010b)
Viscosia sp. LUK3 UK HM564419 Bik et al. (2010b)
Viscosia sp. SBN2 UK HM564595 Bik et al. (2010b)
Viscosia sp. SBN4 UK HM564597 Bik et al. (2010b)
Viscosia dossena Leduc & Zhao, 2023 New Zealand OK317193 Leduc and Zhao (2023)
Oncholaimellinae sp. AS71 USA (A) KR265043 Smythe (2015)
Pontonematinae Pontonema sp. Nem.209 USA (P) MN250102 Pereira et al. (2020)
Pontonema sp. Nem.213 USA (P) MN250105 Pereira et al. (2020)
Enchelidiidae Bathyeurystomina sp. Cr78a FS HM564537 Bik et al. (2010b)
Bathyeurystomina sp. Cr80b FS HM564539 Bik et al. (2010b)
Bathyeurystomina sp. TCR81 USA (P) HM564646 Bik et al. (2010b)
Bathyeurystomina sp. TCR109 USA (P) HM564602 Bik et al. (2010b)
Calyptronema sp. 1068 the Netherlands FJ040503 van Megen et al. (2009)
Calyptronema sp. AUK13 UK HM564400 Bik et al. (2010b)
Calyptronema sp. LUK7 UK HM564421 Bik et al. (2010b)
Calyptronema sp. LUK12 UK HM564418 Bik et al. (2010b)
Eurystomina sp. AS485 Japan KR265038 Smythe (2015)
Pareurystomina sp. BCA3 Antarctica HM564491 Bik et al. (2010b)
Pareurystomina sp. NUS1 USA (A) HM564435 Bik et al. (2010b)
Symplocostoma sp. AS520 Panama (A) KR265050 Smythe (2015)
Enoplidae *Enoplus brevis Bastian, 1865 nd U88336 Aleshin et al. (1998)
*Enoplus meridionalis Steiner, 1921 Croatia Y16914 Kampfer et al. (1998)
Thoracostomopsidae *Enoploides sp. 1252 the Netherlands FJ040490 van Megen et al. (2009)

Results

Taxonomy

Oncholaiminae Filipjev, 1916

Type genus

Oncholaimus Dujardin, 1945.

Diagnosis

(modified from Belogurova and Belogurov 1974; Smol et al. 2014). Oncholaimidae. Cuticle smooth. Buccal cavity barrel-shaped, with three teeth. Left ventrosublateral tooth larger than other teeth (usual) or left and right ventrosublateral teeth of same size. Spicules short or long, gubernaculum present or absent. Copulatory bursa absent. Female reproductive system monodelphic-prodelphic with an antidromously reflexed ovary. Demanian system present or absent.

Remarks

Cobb (1930) established the new genus Oncholaimium Cobb, 1930, which differs from Oncholaimus mainly by the presence of a distinct precloacal appendicule (papilla) in males. Subsequently, Kreis (1932) established Pseudoncholaimus Kreis, 1932 based on the lack of Demanian system. Kreis (1934) also distinguished Oncholaimium from Oncholaimus based on the Demanian system, which is without terminal pore in Oncholaimium and with terminal pores in Oncholaimus. However, Rachor (1969) synonymized Oncholaimium and Pseudoncholaimus to Oncholaimus, because the presence of a Demanian system is unknown for many species of Oncholaimus. Belogurov and Belogurova (1988), who proposed the currently accepted taxonomic system of Oncholaimidae, treated Oncholaimium and Pseudoncholaimus as valid genera. Pseudoncholaimus is still considered valid by several researchers (e.g., Smol et al. 2014; Tsalolikhin 2015; Milovankina and Fadeeva 2019). However, because it is unclear for numerous species whether they rather belong to Oncholaimus, Oncholaimium, or Pseudoncholaimus, we included the latter two in Oncholaimus sensu lato as described by Rachor (1969). Thus, the subfamily Oncholaiminae comprises six genera, i.e., Oncholaimus, Metoncholaimus, Prooncholaimus Micoletzky, 1924, Metaparoncholaimus De Coninck & Schuurmans Stekhoven, 1933, Wiesoncholaimus Inglis, 1966, and Fotolaimus. Members of the Oncholaiminae can be distinguished from these of the other six subfamilies as follows. They are distinct from Krampiinae De Coninck, 1965, Adoncholaiminae Gerlach & Riemann, 1974, and Pontonematinae Gerlach & Riemann, 1974 as they have only one ovary (whereas the three other genera have two); from Pelagonematinae De Coninck, 1965 and Octonchinae De Coninck, 1965 as they have three distinct teeth (whereas Pelagonematinae member have minute or no tooth and Octonchinae have eight or more); and from Oncholaimellinae De Coninck, 1965 because their left ventrosublateral tooth is larger than the other two teeth (right ventrosublateral tooth is larger in Oncholaimellinae). Recent revisional works were provided by Mawson (1958) for Metaparoncholaimus, Yoshimura (1982) for Metoncholaimus, and Chen et al. (2015) for Prooncholaimus.

Fotolaimus Belogurova & Belogurov, 1974

Type species

Fotolaimus marinus Belogurova & Belogurov, 1974.

Diagnosis

(modified from Belogurova and Belogurov 1974). Oncholaiminae. Left ventrosublateral tooth larger than the two other teeth. Spicules shorter than 2.0 cloacal body diameters. Gubernaculum present. Demanian system present, posterior end of main duct forming two symmetrical sacs each with five or more terminal ducts.

Remarks

The genus Fotolaimus can be distinguished from Metaparoncholaimus and Wiesoncholaimus by the left ventrosublateral tooth being larger than the right ventrosublateral tooth (left and right ventrosublateral teeth are equal in size in Metaparoncholaimus and Wiesoncholaimus). It also differs from Prooncholaimus by the absence of the large bubble-like cells in pseudocoelom (presence in Prooncholaimus). Fotolaimus, Oncholaimus, and Metoncholaimus are similar to each other and are distinguished by the morphological characters of the terminal ducts of the Demanian system. Belogurova and Belogurov (1974) characterized the Demanian system of Fotolaimus as follows: the posterior end of the main duct forms two symmetrical sacs, each of which is pierced by five terminal ducts ending in terminal pores. On the other hand, the main ducts of Oncholaimus and Metoncholaimus do not form a sac at the posterior end, but branch separately into two or more terminal ducts (Belogurov and Belogurova 1988). Belogurov and Belogurova (1977) distinguished Metoncholaimus from Oncholaimus in that the terminal ducts are covered with moniliform glands. However, some Metoncholaimus species do not mention the shape of the terminal duct in their description (e.g., Mawson 1958; Salma et al. 2017). For convenience, a species may be considered belonging to Oncholaimus if it has short (equal to cloacal body diameter) spicules and without gubernaculum, and belonging to Metoncholaimus if it has longer spicules (with or without gubernaculum) or short spicules with gubernaculum (cf. Platt and Warwick 1983). The distinction between Oncholaimus and Metoncholaimus will need to be reexamined in the future.

Key to genera in Oncholaiminae (cf. Belogurov and Belogurova 1988; Smol et al. 2014)

1 Right and left ventrosublateral teeth of same size 2
– Left ventrosublateral tooth larger than the other teeth 3
2 Spicule length almost equal to cloacal body diameter Metaparoncholaimus
– Spicules longer than 3.0 cloacal body diameters Wiesoncholaimus
3 Large bubble-like cells present in pseudocoelom Prooncholaimus
– Large bubble-like cells absent 4
4 Demanian system including two posterior sacs Fotolaimus
– Demanian system absent, or present but without posterior sacs 5
5 Terminal ducts covered with moniliform glands Metoncholaimus
– Terminal ducts not covered with moniliform glands Oncholaimus

Fotolaimus cavus sp. nov.

https://zoobank.org/A0509360-77DD-4387-9FAD-92B14758952F
Figs 1, 2, 3, 4, Table 3

Material examined

Holotype. Japan • male (permanent whole mount in glycerin); Ryukyu Islands, Miyako Island Group, Shimoji Island, a submarine cave called Akuma-no-yakata; 24°49'22.5"N, 125°08'07.8"E; 26 Oct. 2018; anchialine zone, depth 7 m, collected by Yoshihisa Fujita; ICHUM 8474.

Paratypes. Japan • two males (permanent whole mounts in glycerin); same collection data as for holotype; 26 Oct. 2018; anchialine zone, depth 20 m, collected by Yoshihisa Fujita; ICHUM 8475 and 8476 • four females (permanent whole mounts in glycerin); same collection data as for preceding; ICHUM 8477–8480.

Other material

Japan • one male (SEM specimen); same collection data as for paratypes; • one female (SEM specimen); same collection data as for preceding.

Etymology

The specific name cavus (cave) is a Latin noun in apposition derived from the type locality.

Description

Body (Fig. 1A, B) elongated, almost cylindrical but gradually tapering toward both extremities. Cuticle smooth throughout body besides oblique striations (Fig. 2A; cf. Leduc 2013) crossing at angle of ca. 120° between amphids and anteriormost cervical setae visualized using SEM. Somatic sensilla arranged in eight longitudinal rows: setiform in anterior half of cervical (Figs 1C, 2B) and caudal (Fig. 2C) regions; papilliform or very short setiform in rest of body (Fig. 2D), difficult to observe without SEM. Cephalic region (Figs 1D–F, 2E–G, 3A–D) rounded at anterior end, with six lips, slightly constricted posterior to amphids, as wide as 0.3–0.4 maximum body diameters at cephalic sensilla level. Six inner labial sensilla papilliform. Six outer labial and four cephalic sensilla setiform, arranged in single circle, 5–8 μm or 0.20–0.30 corresponding body diameters long in males and 6–9 μm or 0.25–0.35 corresponding body diameters long in females. Amphids (Figs 1D, E, 2E, 3B) pocket-like, with elliptical aperture and cup-shaped fovea, 0.40–0.45 corresponding body diameters wide in males and 0.35–0.40 corresponding body diameters wide in females, anterior margin located at 0.4–0.5 buccal cavity lengths from anterior body end. Buccal cavity (Figs 1D–F, 3C, D) barrel-shaped, length/width = 2.5–3.0, surrounded by pharyngeal tissue in posterior 15%–25%. Three well-developed teeth: left ventrosublateral tooth largest, 4–6 μm longer than right and dorsal teeth. Tip of left ventrosublateral tooth at 0.2 buccal cavity lengths from anterior body end (i.e., level of cephalic sensilla). Pharynx (Figs 1C, 3E) cylindrical, evenly muscular, gradually widened toward posterior end. Cardia surrounded by intestine. Rectum (Fig. 4A, B) slightly longer than cloacal body diameter. Pore of secretory-excretory system (Figs 1C, 2H; SE-pore) with ampulla, at 2.0–2.2 buccal cavity lengths or 0.2 pharyngeal lengths from anterior body end. Renette cell not observed. Nerve ring (Fig. 1C) located at 0.45–0.50 pharyngeal lengths from anterior body end. Tail sexually dimorphic: male tail (Figs 2I, J, 3F, 4A) strongly tapering in anterior 1/5, gradually tapering in next 2/5, and almost cylindrical in posterior 2/5, as long as 3.9–5.7 cloacal body diameters; female tail (Figs 3G, 4B) more gradually tapering throughout its length, as long as 5.5–6.1 anal body diameters. Tail tip slightly expanded, with spinneret and one pair of subterminal setae in both sexes. Body diameter at level of cloacal opening or anus equal to 0.5 maximum body diameters, at cylindrical portion of tail equal to 0.20–0.25 cloacal body diameters. Caudal glands inconspicuous. Caudal setae arranged in longitudinal rows, number and location varying from individuals.

Figure 1. 

Line drawings of Fotolaimus cavus sp. nov. A, C, D. Holotype (ICHUM 8474); B, E. Paratype (ICHUM 8477); F. Paratype (ICHUM 8479). A. Male body, right lateral view; B. Female body, right lateral view; C. Male cervical region, right lateral view; D. Male cephalic region, right lateral view; E. Female cephalic region, right lateral view; F. Female cephalic region, dorsal view. Scale bars: 1 mm (A, B); 100 μm (C); 20 μm (D–F).

Figure 2. 

SEM photographs of Fotolaimus cavus sp. nov. A, B, D–F, M–O. Non-type female; C, G–L. Non-type male. A. Oblique striations on cuticle; B. Anterior region; C. Male cloacal region; D. Papilliform somatic sensilla (arrowheads); E. Female cephalic region, lateral view; F. Female cephalic region, anterior view; G. Male cephalic region, anterior view; H. SE-pore; I. Male posterior region with cloacal opening (arrowhead); J. Tail tip with spinneret (arrowhead); K. Cloacal region, subventral view; L. Ventral papillae; M. Vulva; N. Circle of terminal pores; O. Terminal pores. Scale bars: 5 μm (A, H, J, L); 50 μm (B, I); 20 μm (C, E, N); 10 μm (D, F, G, K, M, O).

Figure 3. 

Light micrographs of Fotolaimus cavus sp. nov. A–F, H, J. Holotype (ICHUM 8474); G, K. Paratype (ICHUM 8477); I. Paratype (ICHUM 8475); L. Paratype (ICHUM 8479). A. Anterior region; B. Amphid; C. Buccal cavity with left ventrosublateral tooth; D. Buccal cavity with right ventrosublateral tooth; E. Posterior end of pharynx with cardia; F. Male tail; G. Female tail; H, I. Spicule (black arrowhead) and gubernaculum (white arrowhead); J. Sperms in seminal vesicle; K. Uvette and ductus entericus; L. Terminal pores. Scale bars: 20 μm (A, E, H–K); 10 μm (B–D, L); 100 μm (F, G).

Figure 4. 

Line drawings of Fotolaimus cavus sp. nov. A, C, D. Holotype (ICHUM 8474); B, E, F. Paratype (ICHUM 8477); G. Paratype (ICHUM 8479). A. Male posterior region, right lateral view; B. Female posterior region, right lateral view; C. Spicule and gubernaculum, right lateral view; D. Male reproductive system, right lateral view; E. Female reproductive system, right lateral view; F. Demanian system, right lateral view; G. Demanian system, dorsal view. Scale bars: 50 μm (A, B); 10 μm (C); 100 μm (D–G).

Spicules (Figs 3H, I, 4A, C) paired, arcuate, distally acute with subterminal opening, proximally with capitulum, as long as 1.3–1.5 cloacal body diameters or 0.25–0.35 tail lengths. Gubernaculum (Figs 3H, I, 4A, C) plate-like, distally associated with spicules, proximally curved, shape similar to that of gubernaculum from Admirandus belogurovi Tchesunov, Mokievsky & Nguyen, 2010 (Tchesunov et al. 2010), as long as 0.5–0.7 cloacal body diameters or 0.3–0.5 spicule lengths. No precloacal supplement. Circumcloacal setae (Fig. 2C, K) arranged in single circle, 9–12 setae in each body side. Three ventral papillae (Fig. 2L) present just anterior to cloacal opening, arranged in single longitudinal row, observed only with SEM. Male reproductive system (Fig. 4D) diorchic. Two opposed and outstretched telogonic testes, both situated on right side of intestine: germinal zone filled with small cells not arranged in rows; growth zone with larger cells arranged in single row. Blind end of anterior testis at 30%–40% of body length from anterior end; blind end of posterior testis at 70% of body length from anterior end. Seminal vesicle including two (dorsal and ventral) rows of sperms (Fig. 3J). Vas deference located on ventral side of intestine, anteriorly filled by single row of sperms.

Female reproductive system (Fig. 4E) monodelphic-prodelphic. Telogonic ovary antidromously reflexed, situated on right side of intestine, as long as 6%–10% of body length; anterior end connecting with oviduct at 50%–55% of body length from anterior end; blind end located at 60%–65% of body length from anterior end; germinal zone with small cells not arranged in rows; growth zone with gradually growing cells arranged in two (right and left) rows; ripening zone with grown oocytes arranged in single row. Oviduct situated on left side of ovary (between intestine and ovary). Uterus well developed in two specimens (ICHUM 8477 and 8478), ca. 200 μm in length, each containing one egg (131–141 μm long and 48–62 μm wide). In other two individuals, uterus very short without egg and blind end of ovary located just anterior to vulva. However, the size and degree of maturity of the ovaries similar to those of egg-bearing specimens. Vulva (Figs 2M, 4E) transverse slit with thick cuticular walls, located at 2/3 from anterior body end. Vagina weakly sclerotized. Demanian system (Figs 3K, 4F, G) oncholaimoid type variant D (cf. Belogurov and Belogurova 1988). Ductus uterinus anteriorly inconspicuous. Uvette well-developed, spherical with thick sclerotized wall, situated on right side of intestine at 80%–85% of body lengths, connected to main duct with posterior tip. Main duct on dorsal side of intestine, anteriorly forming one short sac with thick sclerotized wall and filled with sperms, posteriorly forming two sacs on both sides. Ductus entericus very short, situated subterminally on the left side of anterior sac of main duct. Osmosium inconspicuous, may be simple pore. Terminal ducts branching off from posterior sacs of main duct, five or more in number on both sides. Terminal pores (Figs 2N, O, 3L, 4F, G) arranged in single circle surrounding body, 3–4 anal body diameters anterior to anus.

Diagnosis

Fotolaimus cavus sp. nov. is characterized by small body size (2.1–3.0 mm), wide amphids (0.35–0.45 corresponding body diameters), a long buccal cavity (length/width = 2.5–3.0), a long (c = 12–15, c’ = 3.9–6.1) conico-cylindrical tail, and a proximally curved gubernaculum.

Remarks

Fotolaimus cavus sp. nov. differs from the other two species of the genus, i.e., F. marinus and F. apostematus, by the curved shape of the gubernaculum (not curved and smaller in F. marinus and F. apostematus). Fotolaimus cavus sp. nov. is also different from F. marinus by its shorter body (2.1–3.0 mm in F. cavus sp. nov. vs 5.8–6.2 mm in F. marinus) and longer tail (c = 12–15, c’ = 3.9–6.1 in F. cavus sp. nov. vs c = 39–51, c’ = 2.3–3.8 in F. marinus) with conico-cylindrical shape (vs clavate in F. marinus) (cf. Wieser 1959; Belogurova and Belogurov 1974).

Table 3.
Download as
CSV
XLSX

Morphometrics of Fotolaimus cavus sp. nov. All measurements are in μm and in the form: mean ± s.d. (range). *Distance from the anterior body end.

Male Female
Holotype Paratype Paratype
n – 2 4
Body length 2417 2169 ± 109 (2060–2277) 2481 ± 284 (2266–2970)
a 39.6 31 ± 1.2 (29.9–32.1) 34.2 ± 4.0 (30.7–40.7)
b 6.2 6.1 ± 0.1 (6.1–6.2) 6.2 ± 0.6 (5.8–7.2)
c 13.3 13.5 ± 1.7 (11.8–15.1) 12.7 ± 0.8 (11.9–13.7)
V – – 66.0 ± 1.1 (64.9–67.5)
Body diameter at cephalic sensilla 25 24.5 ± 0.5 (24–25) 25.8 ± 0.5 (25–26)
Body diameter at amphids 29 30 31 ± 1.6 (29–33)
Maximum body diameter 61 70.0 ± 1.0 (69–71) 72.8 ± 2.3 (69–75)
Body diameter at vulva – – 68.3 ± 2.8 (65–71)
Body diameter at cloacal opening or anus 32 35 35 ± 0.9 (34–36)
Outer labial and cephalic setae length 5.0–7.5 6.4 ± 0.8 (5.0–7.4) 6.9 ± 1.0 (5.5–9.1)
Amphid position* 20 18 ± 1.0 (17–19) 20 ± 1.9 (18–23)
Amphid width 13 12.5 ± 0.5 (12–13) 12
Buccal cavity length 40 41 ± 1.0 (40–42) 42 ± 0.8 (41–43)
Buccal cavity width 16 15.5 ± 0.5 (15–16) 15.5 ± 0.5 (15–16)
Pharyngeal length 389 356 ± 13 (343–369) 403 ± 11 (386–416)
SE-pore* 85 81 88
Nerve ring* 175 165 ± 8 (157–173) 180 ± 5 (172–185)
Tail length on arc 182 165 ± 28 (137–193) 199 ± 13 (189–218)
Spicule length on arc 47 48 ± 2.5 (45–50) –
Gubernaculum length on arc 17 20 ± 3.0 (17–23) –
Anterior gonad* 785 760 ± 55 (705–814) 1302 ± 94 (1214–1460)
End of posterior gonad* 1732 1546 ± 60 (1486–1606) –
Vulva* – – 1638 ± 200 (1473–1975)
Uvette* – – 2067 ± 278 (1839–2541)
Terminal pores* – – 2163 ± 268 (1961–2622)

Key to Fotolaimus species (cf. Wieser 1959; Belogurova and Belogurov 1974)

1 Tail clavate, as long as 2.0–2.5 cloacal body diameters F. marinus
– Tail conico-cylindrical, longer than 3.0 cloacal body diameters 2
2 Gubernaculum almost straight F. apostematus
– Gubernaculum proximally curved F. cavus sp. nov.

Phylogenetic analysis

We obtained 38 partial COI sequences (315–801 bp) and 22 partial 18S sequences (1221–1692 bp) for seven oncholaimid species including F. cavus sp. nov. (Table 1). The DNA sequences isolated from Fotolaimus species were deposited in the INSD for the first time.

The ML tree based on 18S sequences (Fig. 5) suggested, albeit with low support values, the presence of two major clades within the Oncholaimoidea. The first major clade was composed of two highly supported subclades: all sequences from Adoncholaimus Filipjev, 1918 (SH-aLRT = 100% and UFBoot = 100%), and all sequences from Viscosia de Man, 1890 and several sequences from Oncholaimus, including Pseudoncholaimus (SH-aLRT = 97.3% and UFBoot = 99%). Oncholaimus from South Africa (SBA) and the Atlantic side of the USA (BUS, NAR, NUS, and OUS) did not form clades. Oncholaimus from the UK (AUK) and Japan placed in another major clade. Within the genus Viscosia, 11 sequences from the UK (AUK, HCL, LUK, and SBN) formed one clade, which did not include V. dossena Leduc & Zhao, 2023 from New Zealand. The second major clade contained Pontonema sp. and four well- or moderately-supported subclades: (1) Eurystomina Filipjev, 1921 and Pareurystomina Micoletzky, 1930 (SH-aLRT = 95% and UFBoot = 85%); (2) Bathyeurystomina Lambshead & Platt, 1979 (SH-aLRT ≥ 90% and UFBoot = 100%); (3) Calyptronema Marion, 1870 and Symplocostoma Bastian, 1865 (SH-aLRT = 94.8% and UFBoot = 97%); and (4) parts of Oncholaimus with all Wiesoncholaimus, Fotolaimus, Meyersia Hopper, 1967 and Oncholaimellinae sp. (SH-aLRT = 90.7% and UFBoot = 90%). The support values for a second major clade were not well-supported (SH-aLRT < 70% and UFBoot < 80%).

Figure 5. 

ML tree of Oncholaimoidea based on 18S DNA sequences. Numbers at the nodes are SH-aLRT (left) greater than 70% and UFBoot (right) greater than 80%.

Discussion

The 18S phylogenetic tree (Fig. 5) suggested that Fotolaimus cavus sp. nov. was assembled in one major clade with some members of Oncholaimus and all members of Wiesoncholaimus and Oncholaimellinae sp. with a high level of support (SH-aLRT = 96.3% and UFBoot = 97%). Fotolaimus and Wiesoncholaimus are included, with Oncholaimus, in the subfamily Oncholaiminae (Hodda 2022), and they all present an oncholaimid-type Demanian system (Belogurov and Belogurova 1988). Therefore, the position of Fotolaimus in the Oncholaiminae based on the morphology was supported by molecular phylogeny.

Oncholaimus sp. (KR265044) from Wakayama (Pacific side of central Japan) is considered to be O. secundicollis because DNA sequences obtained from the former was identical to those from the topotypes of O. secundicollis. Oncholaimus secundicollis is distributed on the Pacific and Sea of Japan sides of northeastern Japan (Shimada unpubl.) and on the Sea of Japan side of South Korea (Lee et al. 2015). Wieser (1955) also reported on O. dujardinii de Man, 1876 from Wakayama but provided limited morphological information and no illustration. A redescription of O. dujardinii by the same author (Wieser 1953) mentions a gubernaculum (Zhang and Platt 1983), which should be absent in Oncholaimus. Therefore, O. dujardinii sensu Wieser (1955) may not be a true Oncholaimus.

Meyersia branch has been assembled (SH-aLRT = 90.7% and UFBoot = 90%) with the Oncholaimus–Wiesoncholaimus–Fotolaimus clade. Meyersia did not form the clade with Adoncholaimus, indicating that monophyly of Adoncholaiminae is unlikely. Members of Adoncholaiminae possess two ovaries and a well-developed Demanian system, but other morphological features distinguish Meyersia from the other three genera. Adoncholaimus (including Metoncholaimoides Wieser, 1954), Admirandus Belogurov & Belogurova, 1979, and Kreisoncholaimus Rachor, 1969 have larger teeth on the right side, and the terminal pores of the Demanian system are located near the anus (i.e., much posterior to both ovaries). In contrast, in Meyersia, right and left teeth are large, and the terminal pores of the Demanian system are located at the level of the vulva (i.e., between both ovaries).

Monophyly of Enchelidiidae was not supported by our phylogenetic tree, although previous studies by Bik et al. (2010a, b) evidenced monophyly with 95% of bootstrap values. Monophyly of the clade comprising Calyptronema and Symplocostoma was well supported (SH-aLRT = 94.8% and UFBoot = 97%). Both genera present a sexually dimorphic cephalic region, elongated spicules, and papilliform (not winged) precloacal supplements, and have been considered, together with Symplocostomella Micoletzky, 1930, which has the same three characteristics, closely related groups within Enchelidiidae. Pontonema appeared to be a sister group of the clade consisting of Eurystomina and Pareurystomina Micoletzky, 1930; however, the support values are quite low (SH-aLRT < 70% and UFBoot < 80%), consequently, the position of Pontonema remains uncertain.

Some members of Oncholaimus and all members of Pseudoncholaimus and Viscosia appear to be monophyletic (SH-aLRT = 97.3% and UFBoot = 99%). As aforementioned, Pseudoncholaimus is considered a junior synonym of Oncholaimus, but both taxa can be distinguished by the presence or absence of Demanian system. Our tree strongly suggested that unidentified Oncholaimus spp. was not clustered in a single clade. The species of Oncholaimus clustered with Pseudoncholaimus might not have a Demanian system. In fact, the species that doubtlessly had a Demanian system (O. secundicollis) belonged to a separate clade from Pseudoncholaimus. Fotolaimus and Wiesoncholaimus, suggested to be closely related to O. secundicollis, also have a Demanian system. Therefore, there was no evidence supporting the synonymization of Pseudoncholaimus with Oncholaimus. Because members of Oncholaimus (in which the left tooth is the largest) are included in two well-supported clades, which both contain Oncholaimellinae spp. (in which the right tooth is the largest), it is likely that the size of the left and right teeth does not reflect phylogenetic relationships. Additionally, Wiesoncholaimus, in which left and right teeth are large, was in the same clade as Oncholaimus and Fotolaimus, suggesting that the teeth size has evolved independently many times.

In Bik et al. (2010a, b) and Smythe (2015), the phylogenetic position of Adoncholaimus within Oncholaimoidea was not clear. Our phylogenetic analysis suggested that Adoncholaimus is a sister clade of Oncholaimus–Pseudoncholaimus–Viscosia clade with a certain degree of support (SH-aLRT = 78.9% and UFBoot = 91%).

Acknowledgements

We wish to thank Hiroki Ichi (Irabu-jima Fishery Cooperative), Masaru Mizuyama (Meio University), Katrine Worsaae (University of Copenhagen), Peter Rask Møller (Natural History Museum Denmark, University of Copenhagen), and Go Tomitani (Diving Service “Marines Pro Miyako”) for helping with scuba diving and sampling in the submarine cave. Thanks are also extended to Hiroaki Nakano (Shimoda Marine Research Center, University of Tsukuba), Hisanori Kohtsuka (Misaki Marine Biological Station, the University of Tokyo), and all the other participants to the 7th Japanese Association for Marine Biology (JAMBIO) Coastal Organism Joint Survey for their help in collecting Wiesoncholaimus jambio. We would like to thank Enago (https://www.enago.jp/) for the English language review. This study was partly supported by JSPS KAKENHI Grant Numbers JP21K06299 to DS and JP20H03313 to YF and KK.

References

  • Ahmed M, Roberts NG, Adediran F, Smythe AB, Kocot KM, Holovachov O (2022) Phylogenomic analysis of the phylum Nematoda: Conflicts and congruences with morphology, 18S rRNA, and mitogenomes. Frontiers in Ecology and Evolution 9: e769565. https://doi.org/10.3389/fevo.2021.769565
  • Aleshin VV, Milyutina IA, Kedrova OS, Vladychenskaya NS, Petrov NB (1998) Phylogeny of Nematoda and Cephalorhyncha derived from 18S rDNA. Journal of Molecular Evolution 47(5): 597–605. https://doi.org/10.1007/PL00006416
  • Anker A, Fujita Y (2014) On the presence of the anchialine shrimp Calliasmata pholidota Holthuis, 1973 (Crustacea: Decapoda: Caridea: Barbouriidae) in Shimoji Island, Ryukyu Islands, Japan. Fauna Ryukyuana 17: 7–11.
  • Ape F, Arigò C, Gristine M, Genovese L, di Franco A, di Lorenzo M, Baiata P, Aglieri G, Milisenda G, Mirto S (2015) Meiofaunal diversity and nematode assemblages in two submarine caves of a Mediterranean marine protected area. Mediterranean Marine Science 17(1): 202–215. https://doi.org/10.12681/mms.1375
  • Arunimaand TKA, Mohan PM (2021) Meiofauna from marine and anchialine caves. Journal of the Andaman Science Association 26(2): 131–140.
  • Belogurov OI, Belogurova LS (1977) Systematics and evolution of Oncholaiminae (Nematoda). I. Significance of the de Manian system. Biologiya Morya [Биология моря] 1977(3): 36–47. [In Russian with English abstract]
  • Belogurov OI, Belogurova LS (1988) Morphology and systematics of free-living Oncholaimidae (Nematoda: Enoplida: Oncholaimina). Far Eastern Branch of the USSR Academy of Sciences, Vladivostok, 99 pp. [In Russian]
  • Belogurova LS, Belogurov OI (1974) Fotolaimus marinus gen. et sp. n. (Nematoda, Oncholaimidae) from the Schikotan Island (Kuril Islands). Zoologicheskiy jurnal [Зоологический журнал] 53(10): 1566–1568. [In Russian with English abstract]
  • Bik HM, Lambshead PJD, Thomas WK, Lunt DH (2010a) Moving towards a complete molecular framework of the Nematoda: A focus on the Enoplida and early-branching clades. BMC Evolutionary Biology 10(1): e353. https://doi.org/10.1186/1471-2148-10-353
  • Bik HM, Thomas WK, Lunt DH, Lambshead PJD (2010b) Low endemism, continued deep-shallow interchanges, and evidence for cosmopolitan distributions in free-living marine nematodes (order Enoplida). BMC Evolutionary Biology 10(1): e389. https://doi.org/10.1186/1471-2148-10-389
  • Chen CA, Nguyen DT, Smol N (2015) Two new free-living marine nematode species from an intertidal sandy-rocky shore on Pulau Ubin, Singapore with a key to the valid species of the genera Prooncholaimus and Acanthonchus. The Raffles Bulletin of Zoology (Supplement 31): 68–74.
  • Cobb NA (1930) The demanian vessels in nemas of the genus Oncholaimus; with notes on four new oncholaims. Journal of the Washington Academy of Sciences 20(12): 225–241.
  • D’Addabbo R, De Leonardis C, Sandulli R, Gallo M (2008) Further studies of meiofauna and tardigrade fauna in two Italian marine protected areas. Biologia Marina Mediterranea 15(1): 262–263.
  • De Ley IT, De Ley P, Vierstraete A, Karssen G, Moens M, Vanfleteren J (2002) Phylogenetic analyses of Meloidogyne small subunit rDNA. Journal of Nematology 34(4): 319–327.
  • Decraemer W, Coomans A, Baldwin J (2014) Morphology of Nematoda. In: Schmidt-Rhaesa A (Ed.) Handbook of Zoology. Gastrotricha, Cycloneuralia and Gnathifera (Vol. 2). Nematoda. De Gruyter, Berlin and Boston, 1–59. https://doi.org/10.1515/9783110274257.1
  • Derycke S, Remerie T, Vierstraete A, Backeljau T, Vanfleteren J, Vincx M, Moens T (2005) Mitochondrial DNA variation and cryptic speciation within the free-living marine nematode Pellioditis marina. Marine Ecology Progress Series 300: 91–103. https://doi.org/10.3354/meps300091
  • Díez B, Pedrós-Alió C, Massana R (2001) Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Applied and Environmental Microbiology 67(7): 2932–2941. https://doi.org/10.1128/AEM.67.7.2932-2941.2001
  • Fujita Y, Naruse T, Yamada Y (2013) Two submarine cavernicolous crabs, Atoportunus gustavi Ng & Takeda, 2003, and Neoliomera cerasinus Ng, 2002 (Crustacea: Decapoda: Brachyura: Portunidae and Xanthidae), from Shimojijima Island, Miyako Group, Ryukyu Islands, Japan. Fauna Ryukyuana 1: 1–9. [In Japanese with English abstract]
  • Fujita Y, Mizuyama M, Yamada Y (2017) Bresilia rufioculus Komai & Yamada, 2011 (Decapoda: Caridea: Bresiliidae) from a submarine cave in Shimoji-jima Island, Miyako Island Group, southern Ryukyus, Japan. Fauna Ryukyuana 37: 31–33.
  • García-Valdecasas Huelín A (1985) Estudio faunístico de la cueva submarina ‹‹Túnel de la Atlántida››, Jameos del Agua, Lanzarote. Naturalia Hispanica 27: 1–56.
  • Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Systematic Biology 59(3): 307–321. https://doi.org/10.1093/sysbio/syq010
  • Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35(2): 518–522. https://doi.org/10.1093/molbev/msx281
  • Hooper DJ (1986) Drawing and measuring nematodes. In: Southey JF (Ed.) Laboratory Methods for Work with Plant and Soil Nematodes (6th Edn. ). Her Majesty’s Stationery Office, London, 87–94.
  • Ise Y, Vacelet J, Mizuyama M, Fujita Y (2023) New lithistid sponge of the genus Sollasipelta (Porifera, Demospongiae, Tetractinellida, Neopeltidae) from submarine caves of the Ryukyu Islands, southwestern Japan, with redescription of S. sollasi. Zootaxa 5285(2): 293–310. https://doi.org/10.11646/zootaxa.5285.2.4
  • Iwahori H (2014) Senchū kara no DNA chūshutsuhō [DNA extraction methods for nematodes]. In: Mizukubo T, Futai K (Eds) Senchūgaku Jikkenhō [Nematological Experimentation]. Kyoto University Press, Kyoto, 50–55. [In Japanese]
  • Kakui K, Fujita Y (2018) Haimormus shimojiensis, a new genus and species of Pseudozeuxidae (Crustacea: Tanaidacea) from a submarine limestone cave in Northwestern Pacific. PeerJ 6: e4720. https://doi.org/10.7717/peerj.4720
  • Kakui K, Fujita Y (2020) Paradoxapseudes shimojiensis sp. nov. (Crustacea: Tanaidacea: Apseudidae) from a submarine limestone cave in Japan, with notes on its chelipedal morphology and sexual system. Marine Biology Research 16(3): 195–207. https://doi.org/10.1080/17451000.2020.1720249
  • Kakui K, Fujita Y (2023) New sea spider species (Pycnogonida: Austrodecidae) from a submarine cave in Japan. Journal of the Marine Biological Association of the United Kingdom 103: E44. https://doi.org/10.1017/S0025315423000322
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Kampfer S, Sturmbauer C, Ott J (1998) Phylogenetic analysis of rDNA sequences from adenophorean nematodes and implications for the Adenophorea-Secernentea controversy. Invertebrate Biology 117(1): 29–36. https://doi.org/10.2307/3226849
  • Kanzaki N, Futai K (2002) A PCR primer set for determination of phylogenetic relationships of Bursaphelenchus species within the xylophilus group. Nematology 4(1): 35–41. https://doi.org/10.1163/156854102760082186
  • Kreis HA (1932) Papers from Dr. Th. Mortensen’s Pacific Expedition 1914–16. LXI. Freilebende marine Nematoden von den Sunda-Inseln. II. Oncholaiminae. Videnskabelige Meddelelser fra Dansk naturhistorisk Forening i København 93: 23–69.
  • Kreis HA (1934) Oncholaiminae Filipjev, 1916. Eine monographische Studie. Capita Zoologica 4(5): 1–271.
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Leduc D, Zhao ZQ (2023) The marine biota of Aotearoa New Zealand. Ngā toke o Parumoana: Common free-living Nematoda of Pāuatahanui Inlet, Te Awarua-o-Porirua Harbour, Wellington. NIWA Biodiversity Memoir 135: 1–212.
  • Lee HJ, Rho HS, Jung J (2015) New record of the genus Oncholaimus nematode species (Nematoda: Oncholaimidae) from the East Sea of Korea. Hangug Hwangyeong Saengmul Haghoeji 33(2): 170–176. https://doi.org/10.11626/KJEB.2015.33.2.170
  • Lemoine F, Correia D, Lefort V, Doppelt-Azeroual O, Mareuil F, Cohen-Boulakia S, Gascuel O (2019) NGPhylogeny.fr: New generation phylogenetic services for non-specialists. Nucleic Acids Research 47(W1): W260–W265. https://doi.org/10.1093/nar/gkz303
  • Lorenz R, Bernhart SH, Höner zu Siederdissen C, Tafer H, Flamm C, Stadler PF, Hofacker IL (2011) ViennaRNA Package 2.0. Algorithms for Molecular Biology 6: e26. https://doi.org/10.1186/1748-7188-6-26
  • Lorenzen S (1981) Entwurf eines phylogenetischen Systems der freilebenden Nematoden. Veröffentlichungen des Instituts für Meeresforschung in Bremerhaven (Supplement 7): 1–472.
  • Mawson PM (1958) Free-living nematodes. Section 3: Enoploidea from Subantarctic stations. British, Australian, and New Zealand Antarctic Research Expedition 1929–1931. Reports Series B. Zoology and Botany 6(14): 309–358.
  • Meldal BHM, Debenham NJ, De Ley P, De Ley IT, Vanfleteren JR, Vierstraete AR, Bert W, Borgonie G, Moens T, Tyler PA, Austen MC, Blaxter ML, Rogers AD, Lambshead PJD (2007) An improved molecular phylogeny of the Nematoda with special emphasis on marine taxa. Molecular Phylogenetics and Evolution 42(3): 622–636. https://doi.org/10.1016/j.ympev.2006.08.025
  • Milovankina AA, Fadeeva NP (2019) Spatial distribution of nematode communities along the salinity gradient in the two estuaries of the Sea of Japan. Russian Journal of Nematology 27(1): 1–12.
  • Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear R (2020) IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37: 1530–1534. https://doi.org/10.1093/molbev/msaa015
  • Mizuyama M, Kudo H, Fujita Y (2022) Discovery of living Chama cerion Matsukuma, Paulay & Hamada, 2003 (Mollusca: Bivalvia: Chamidae) from submarine caves in the Ryukyu Islands, southwestern Japan. Fauna Ryukyuana 64: 65–73.
  • Mullin PG, Harris TS, Powers TO (2005) Phylogenetic relationships of Nygolaimina and Dorylaimina (Nematoda: Dorylaimida) inferred from small subunit ribosomal DNA sequences. Nematology 7(1): 59–79. https://doi.org/10.1163/1568541054192199
  • Nation JL (1983) A new method using hexamethyldisilazane for preparation of soft insect tissues for scanning electron microscopy. Stain Technology 58(6): 347–351. https://doi.org/10.3109/10520298309066811
  • Okanishi M, Fujita Y (2018) A new species of Ophioconis (Echinodermata: Ophiuroidea) from Ryukyu Islands, southwestern Japan. Proceedings of the Biological Society of Washington 131(1): 163–174. https://doi.org/10.2988/18-00001
  • Okanishi M, Fujita Y (2019) A comprehensive taxonomic list of brittle stars (Echinodermata: Ophiuroidea) from submarine caves of the Ryukyu Islands, southwestern Japan, with a description of a rare species, Dougaloplus echinatus (Amphiuridae). Zootaxa 4571(1): 73–98. https://doi.org/10.11646/zootaxa.4571.1.5
  • Osawa M, Fujita Y (2016) Stomatopods and decapods of Axiidea, Gebiidea and Anomura (Crustacea: Malacostraca) from Irabu-jima and Shimojijima Islands, Miyako Group, southern Ryukyus, Japan. Fauna Ryukyuana 28: 37–56. [In Japanese with English abstract]
  • Osawa M, Fujita Y (2019) Submarine cave hermit crabs (Crustacea: Decapoda: Anomura: Paguroidea) from three islands of the Ryukyu Islands, southwestern Japan. Zootaxa 4560(3): 463–482. https://doi.org/10.11646/zootaxa.4560.3.3
  • Pereira TJ, Fonseca G, Mundo-Ocampo M, Guilherme BC, Rocha-Olivares A (2010) Diversity of free-living marine nematodes (Enoplida) from Baja California assessed by integrative taxonomy. Marine Biology 157(8): 1665–1678. https://doi.org/10.1007/s00227-010-1439-z
  • Pereira TJ, De Santiago A, Schuelke T, Hardy SM, Bik HM (2020) The impact of intragenomic rRNA variation on metabarcoding-derived diversity estimates: A case study from marine nematodes. Environmental DNA 2(4): 519–534. https://doi.org/10.1002/edn3.77
  • Platt HM, Warwick RM (1983) Free-living Marine Nematodes. Part I. British Enoplids. Cambridge University Press, Cambridge, 307 pp.
  • Pérez-García JA, Díaz-Delgado Y, García-Machado E, Martínez-García A, Gonzalez BC, Worsaae K, Armenteros M (2018) Nematode diversity of freshwater and anchialine caves of western Cuba. Proceedings of the Biological Society of Washington 131(1): 144–155. https://doi.org/10.2988/17-00024
  • Rachor E (1969) Das de Mansche Organ der Oncholaimidae, eine genito-intestinale Verbindung bei Nematoden. Zoomorphology 66(2): 87–166. https://doi.org/10.1007/BF00277650
  • Riera R, Monterroso Ó, Núñez J, Martínez A (2018) Distribution of meiofaunal abundances in a marine cave complex with secondary openings and freshwater filtrations. Marine Biodiversity 48(1): 203–215. https://doi.org/10.1007/s12526-016-0586-y
  • Saito T, Fujita Y (2022) A new shrimp of the genus Odontozona Holthuis, 1946 (Decapoda: Stenopodidea: Stenopodidae) from a submarine cave of the Ryukyu Islands, Indo-West Pacific. Zootaxa 5175(4): 439–452. https://doi.org/10.11646/zootaxa.5175.4.2
  • Salma J, Nasira K, Saima M, Shahina F (2017) Morphological and molecular identification of four new species of marine nematodes. Pakistan Journal of Nematology 35(2): 113–150. https://doi.org/10.18681/pjn.v35.i02.p113-150
  • Shimada D, Suzuki AC, Tsujimoto M, Imura S, Kakui K (2021) Two new species of free-living marine nematodes (Nematoda: Axonolaimidae and Tripyloididae) from the coast of Antarctica. Species Diversity 26(1): 49–63. https://doi.org/10.12782/specdiv.26.49
  • Smol N, Muthumbi A, Sharma J (2014) Order Enoplida. In: Schmidt-Rhaesa A (Ed.) Handbook of Zoology. Gastrotricha, Cycloneuralia and Gnathifera (Vol. 2). Nematoda. De Gruyter, Berlin and Boston, 193–249. https://doi.org/10.1515/9783110274257.193
  • Smythe AB (2015) Evolution of feeding structures in the marine nematode order Enoplida. Integrative and Comparative Biology 55(2): 228–240. https://doi.org/10.1093/icb/icv043
  • Smythe AB, Holovachov O, Kocot KM (2019) Improved phylogenomic sampling of free-living nematodes enhances resolution of higher-level nematode phylogeny. BMC Evolutionary Biology 19(1): e121. https://doi.org/10.1186/s12862-019-1444-x
  • Talavera G, Castresana J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56(4): 564–577. https://doi.org/10.1080/10635150701472164
  • Tchesunov AV, Mokievsky VO, Nguyen VT (2010) Three new free-living nematode species (Nematoda, Enoplida) from mangrove habitats of Nha Trang, Central Vietnam. Russian Journal of Nematology 18(2): 155–172.
  • Tsalolikhin SY (2015) Pseudoncholaimus spartacus sp. n. (Nematoda, Enoplida, Oncholaimidae) from western India. Zoologicheskiy jurnal [Зоологический журнал] 94(8): 985–988. https://doi.org/10.7868/S0044513415080164 [In Russian with English abstract]
  • van Megen H, van den Elsen S, Holterman M, Karssen G, Mooyman P, Bongers T, Holovachov O, Bakker J, Helder J (2009) A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences. Nematology 11(6): 927–950. https://doi.org/10.1163/156854109X456862
  • Wieser W (1953) Reports of the Lund University Chile Expedition 1948–1949. 10. Free-living marine nematodes. I. Enoploidea. Acta Universitatis Lundensis. Nova Series. Andra Afdelningen 49(6): 1–155.
  • Wieser W (1954) Beiträge zur Kenntnis der Nematoden submariner Höhlen. Ergebnisse der österreichischen Tyrrhenia-Expedition 1952, Teil II. Österreichische Zoologische Zeitschrift 5: 172–230.
  • Wieser W (1955) A collection of marine nematodes from Japan. Publications of the Seto Marine Biological Laboratory 4(2–3): 159–181. https://doi.org/10.5134/174529
  • Wieser W (1959) Free-living Nematodes and Other Small Invertebrates of Puget Sound Beaches. University of Washington Press, Seattle, 179 pp.
  • Worsaae K, Hansen MJ, Axelsen O, Kakui K, Møller PR, Osborn KJ, Martínez A, Gonzalez BC, Miyamoto N, Fujita Y (2021) A new cave-dwelling genus and species of Nerillidae (Annelida) from the Ryukyu Islands, Japan. Marine Biodiversity 51(4): e67. https://doi.org/10.1007/s12526-021-01199-4
  • Yoder M, Tandingan De Ley I, King IW, Mundo-Ocampo M, Mann J, Blaxter M, Poiras L, De Ley P (2006) DESS: A versatile solution for preserving morphology and extractable DNA of nematodes. Nematology 8(3): 367–376. https://doi.org/10.1163/156854106778493448
  • Yoshimura K (1982) Free-living marine nematodes from Kii Peninsula. II. Publications of the Seto Marine Biological Laboratory 27(1–3): 133–142. https://doi.org/10.5134/176043
  • Zhang ZN, Platt HM (1983) New species of marine nematodes from Qingdao, China. Bulletin of the British Museum (Natural History). Bulletin of the British Museum, Natural History. Zoology 45(5): 253–261. https://doi.org/10.5962/p.28001
login to comment